LXL04_030406 | RubberDandelionOmics

Gene overview

LXL04_030406

Reference: OH-1004 Chr: Chr06 Coordinates: 115487714-115488739 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1026 bp · LXL04_030406|LXL04_030406|OH1004|cDNA

ATGGAAATCTTATATATGAGAGATAACGGCGATGATGAGCAAACTTACTTCACTAAACAAGAATCAATGCTACTACAACAAACTAACCAAAGTCCATCTTCACCGCCGTCTCcgccaccaccagccaccgcATCACCTCCGTCGGTATCTTCATCTCCCACTCATGAATTCTCCTTCACCGTGTCCCTCCACCCACACCCGCCACCATCTTTCACTCAAAATCATAGTTCTCATAGTTATGATTGCGATAGCAGTAACAC...

CDS

Download CDS FASTA

1026 bp · LXL04_030406|LXL04_030406|OH1004|CDS

ATGGAAATCTTATATATGAGAGATAACGGCGATGATGAGCAAACTTACTTCACTAAACAAGAATCAATGCTACTACAACAAACTAACCAAAGTCCATCTTCACCGCCGTCTCCGCCACCACCAGCCACCGCATCACCTCCGTCGGTATCTTCATCTCCCACTCATGAATTCTCCTTCACCGTGTCCCTCCACCCACACCCGCCACCATCTTTCACTCAAAATCATAGTTCTCATAGTTATGATTGCGATAGCAGTAACAC...

Protein

Download Protein FASTA

341 aa · LXL04_030406|LXL04_030406|OH1004|PROTEIN

MEILYMRDNGDDEQTYFTKQESMLLQQTNQSPSSPPSPPPPATASPPSVSSSPTHEFSFTVSLHPHPPPSFTQNHSSHSYDCDSSNTNTISSLLPSPPLTAIDLSPADDIFFHGHLLPLHHHLSPLSVSPRSSTNSMDSFTLPTNLLYDVTDPIGNTSFHCHHQTAFSDFEESGVAAGSNQNRPKSKSFSLFSIPKWKKRSDDERESDEDKNRERNNYKKLKLDLSQLIKRYMKMVRPLLSFPKSRRSNTTKFTHQSYSF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030406`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030406

Location Chr06:115487714-115488739 (+)

Description Similar to BKI1: BRI1 kinase inhibitor 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g42750`	Negative regulator of brassinosteroid signaling.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0459500`	Negative regulator of brassinosteroid signaling.	No verified direct reference in this release
`UniProt: A2Z225`	Negative regulator of brassinosteroid signaling.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030406 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006629 lipid metabolic process Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0010423 negative regulation of brassinosteroid biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004860 protein kinase inhibitor activity Molecular Function

GO:0019210 kinase inhibitor activity Molecular Function

GO:0046982 protein heterodimerization activity Molecular Function

KEGG gene cross-reference

ath:AT5G42750

dosa:Os09g0459500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.498

Rank 1 · LXL04_030406 · OH-1004

Nucleus0.381

Rank 2 · LXL04_030406 · OH-1004

Cytoplasm0.341

Rank 3 · LXL04_030406 · OH-1004

Endoplasmic reticulum0.046

Rank 4 · LXL04_030406 · OH-1004

Golgi apparatus0.022

Rank 5 · LXL04_030406 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30743.1BKI145-339 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030406	`PF30743.1`	BKI1	45	339	2e-85	287.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FMZ0`	Arabidopsis thaliana	BRI1 kinase inhibitor 1	38.920%	Swiss-Prot	moderate database homology
`Q67J19`	Oryza sativa subsp. japonica	Probable BRI1 kinase inhibitor 1	42.222%	Swiss-Prot	weak database homology
`A2Z225`	Oryza sativa subsp. indica	Probable BRI1 kinase inhibitor 1	42.222%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card