LXL04_030389 | RubberDandelionOmics

Gene overview

LXL04_030389

Reference: OH-1004 Chr: Chr06 Coordinates: 115152955-115153971 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

498 bp · LXL04_030389|LXL04_030389|OH1004|cDNA

ATGTCTGCCATGTTGGAAGATGCTATTGTTTCATTTCAAAACCTTAGTATGGAAGAGCACAAGGAATCTGAACTGGAATCGACGACCGAACTATCACAACAGGCGCCGCGTAGTTTGGAGGAGGTGGAAGAAATGACAGGCGACTCTGTTTTAAATCTTTTGGTAGCTATTCTACATTACTTGGATTATCCGAATTTGGCTCCAGGTGGGTTGACTCGGTTGCGCTCCGCGAACGTCCATACAGAGGTGTTGGCCCGGGC...

CDS

Download CDS FASTA

498 bp · LXL04_030389|LXL04_030389|OH1004|CDS

ATGTCTGCCATGTTGGAAGATGCTATTGTTTCATTTCAAAACCTTAGTATGGAAGAGCACAAGGAATCTGAACTGGAATCGACGACCGAACTATCACAACAGGCGCCGCGTAGTTTGGAGGAGGTGGAAGAAATGACAGGCGACTCTGTTTTAAATCTTTTGGTAGCTATTCTACATTACTTGGATTATCCGAATTTGGCTCCAGGTGGGTTGACTCGGTTGCGCTCCGCGAACGTCCATACAGAGGTGTTGGCCCGGGC...

Protein

Download Protein FASTA

165 aa · LXL04_030389|LXL04_030389|OH1004|PROTEIN

MSAMLEDAIVSFQNLSMEEHKESELESTTELSQQAPRSLEEVEEMTGDSVLNLLVAILHYLDYPNLAPGGLTRLRSANVHTEVLARAALKYGSLDTTWEGVKQQIKDALWKETGGIEIYINSELIGRGKHKKKKTIATNRAADDANNNFFGGGEGGWDSSFLTTL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030389`
TK1151 ID	TkA07G400870
OH-1004 ID	LXL04_030389
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	88.400
Protein coverage (%)	TK1151 86.154 / OH-1004 67.879 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030389

Location Chr06:115152955-115153971 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20420`	Ribonuclease that cleaves double-stranded RNA (dsRNA).	Characterization of a ribonuclease III-like protein required for cleavage of the pre-rRNA in the 3'ETS in Arabidopsis.2008 · DOI: 10.1093/nar/gkm1130 An Arabidopsis RNase III-like protein, AtRTL2, cleaves double-stranded RNA in vitro.2011 · DOI: 10.1007/s10265-010-0382-x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0358800`	Cleaves double-stranded RNA (dsRNA).	No verified direct reference in this release
`Os05g0271300`	Cleaves double-stranded RNA (dsRNA).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030389 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006364 rRNA processing Biological Process

GO:0030422 siRNA processing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0004525 ribonuclease III activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G20420

dosa:Os05g0271300

dosa:Os06g0358800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.643

Rank 1 · LXL04_030389 · OH-1004

Cytoplasm0.397

Rank 2 · LXL04_030389 · OH-1004

Cell membrane0.046

Rank 3 · LXL04_030389 · OH-1004

Mitochondrion0.040

Rank 4 · LXL04_030389 · OH-1004

Endoplasmic reticulum0.034

Rank 5 · LXL04_030389 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00636.32Ribonuclease_344-99 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030389	`PF00636.32`	Ribonuclease_3	44	99	1.5e-08	36.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LTQ0`	Arabidopsis thaliana	Ribonuclease 3-like protein 2	48.980%	Swiss-Prot	weak database homology
`Q69KJ0`	Oryza sativa subsp. japonica	Ribonuclease 3-like protein 3	51.020%	Swiss-Prot	weak database homology
`Q6ATG6`	Oryza sativa subsp. japonica	Ribonuclease 3-like protein 2	47.917%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card