LXL04_030365 | RubberDandelionOmics

Gene overview

LXL04_030365

Reference: OH-1004 Chr: Chr06 Coordinates: 114912125-114917108 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2784 bp · LXL04_030365|LXL04_030365|OH1004|cDNA

ATGGCCAATAATTCTCAATATCCTGGCATACAGCCTCCTAGACCTCCTGTTGCTCAAATGGGCCCACCCCAAAACACATATCCATCAGTACCAATGCAAttTCGTGCAGCAGGTCCACCTCGGCCCCCACCCCAATACATGCCATTGGTGTCTCAACAGTTTTTACCTGTAGGGAGGCCACCTATGCAACACCTACCGCCACATGGCATGGTCCCACCCCCCGCCCCACCCGCCCCCCAACCTTTTTCACTGCCAGATGG...

CDS

Download CDS FASTA

2784 bp · LXL04_030365|LXL04_030365|OH1004|CDS

ATGGCCAATAATTCTCAATATCCTGGCATACAGCCTCCTAGACCTCCTGTTGCTCAAATGGGCCCACCCCAAAACACATATCCATCAGTACCAATGCAATTTCGTGCAGCAGGTCCACCTCGGCCCCCACCCCAATACATGCCATTGGTGTCTCAACAGTTTTTACCTGTAGGGAGGCCACCTATGCAACACCTACCGCCACATGGCATGGTCCCACCCCCCGCCCCACCCGCCCCCCAACCTTTTTCACTGCCAGATGG...

Protein

Download Protein FASTA

927 aa · LXL04_030365|LXL04_030365|OH1004|PROTEIN

MANNSQYPGIQPPRPPVAQMGPPQNTYPSVPMQFRAAGPPRPPPQYMPLVSQQFLPVGRPPMQHLPPHGMVPPPAPPAPQPFSLPDGSRVAFSITYNLSTSATSQVHISTEAASQYQTTSLINNNNNNNNNNNNNNIPSLPLLQPADQTPPDAPSVPVTNDVPKAVEKTPSDWIEHTSRNGKIYYHNKKTKLSSWEKPLDLMTPVERADASTDWKECIAPIGRKYYYNKVTKQSKWKIPDELKVAREQVKSESKTKNHEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030365`
TK1151 ID	TkA07G399820
OH-1004 ID	LXL04_030365
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030365

Location Chr06:114912125-114917108 (+)

Description Similar to PRP40A: Pre-mRNA-processing protein 40A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g44910`	Binds the phosphorylated C-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries (Probable).	No verified direct reference in this release
`At3g19670`	Binds the phosphorylated C-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries.	Arabidopsis thaliana PRP40s are RNA polymerase II C-terminal domain-associating proteins.2009 · DOI: 10.1016/j.abb.2009.01.004

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030365 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000395 mRNA 5'-splice site recognition Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0007010 cytoskeleton organization Biological Process

GO:0008360 regulation of cell shape Biological Process

GO:0008380 RNA splicing Biological Process

GO:0016477 cell migration Biological Process

GO:0032465 regulation of cytokinesis Biological Process

GO:0045292 mRNA cis splicing, via spliceosome Biological Process

GO:0051301 cell division Biological Process

GO:0000243 commitment complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G44910

ath:AT3G19670

hsa:55660

mmu:56194

spo:2543409

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.938

Rank 1 · LXL04_030365 · OH-1004

Cytoplasm0.133

Rank 2 · LXL04_030365 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_030365 · OH-1004

Mitochondrion0.011

Rank 4 · LXL04_030365 · OH-1004

Endoplasmic reticulum0.011

Rank 5 · LXL04_030365 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00397.33WW170-198 aa

PF00397.33WW213-239 aa

PF01846.26FF387-436 aa

PF01846.26FF454-504 aa

PF01846.26FF522-571 aa

PF01846.26FF596-651 aa

PF25432.2FF_PRPF40A659-718 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030365	`PF00397.33`	WW	170	198	3.2e-19	69.4
LXL04_030365	`PF00397.33`	WW	213	239	3.2e-19	69.4
LXL04_030365	`PF01846.26`	FF	387	436	2.9e-45	152.8
LXL04_030365	`PF01846.26`	FF	454	504	2.9e-45	152.8
LXL04_030365	`PF01846.26`	FF	522	571	2.9e-45	152.8
LXL04_030365	`PF01846.26`	FF	596	651	2.9e-45	152.8
LXL04_030365	`PF25432.2`	FF_PRPF40A	659	718	1.4e-21	76.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B6EUA9`	Arabidopsis thaliana	Pre-mRNA-processing protein 40A	41.844%	Swiss-Prot	moderate database homology
`F4JCC1`	Arabidopsis thaliana	Pre-mRNA-processing protein 40B	39.707%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card