LXL04_030325 | RubberDandelionOmics

Gene overview

LXL04_030325

Reference: OH-1004 Chr: Chr06 Coordinates: 114334571-114340711 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1314 bp · LXL04_030325|LXL04_030325|OH1004|cDNA

ATGGCATCATCCATTGTGTGTTTCGGAGAGATGTTGATTGATTTCGTCCCTGACACCGCCGGAGTCTCCTTGGCCGAGTCTCAAGGATTCCTCAAAGCCCCCGGTGGGGCACCTGCAAACGTCGCTTGTGCCATCACCAAGCTCGGTGGCTCCTCCGCTTTCATTGGCAAGGTTGGGAAGGATGAGTTTGGATACATGTTGGCAGAGATATTGAAGAAGAATGGAGTCAATGCTGACGGAGTTTTGTTCGATGAGCATGC...

CDS

Download CDS FASTA

1314 bp · LXL04_030325|LXL04_030325|OH1004|CDS

ATGGCATCATCCATTGTGTGTTTCGGAGAGATGTTGATTGATTTCGTCCCTGACACCGCCGGAGTCTCCTTGGCCGAGTCTCAAGGATTCCTCAAAGCCCCCGGTGGGGCACCTGCAAACGTCGCTTGTGCCATCACCAAGCTCGGTGGCTCCTCCGCTTTCATTGGCAAGGTTGGGAAGGATGAGTTTGGATACATGTTGGCAGAGATATTGAAGAAGAATGGAGTCAATGCTGACGGAGTTTTGTTCGATGAGCATGC...

Protein

Download Protein FASTA

437 aa · LXL04_030325|LXL04_030325|OH1004|PROTEIN

MASSIVCFGEMLIDFVPDTAGVSLAESQGFLKAPGGAPANVACAITKLGGSSAFIGKVGKDEFGYMLAEILKKNGVNADGVLFDEHARTALAFVTLKKNGEREFMFYRNPSADMLLKESELNKDLIKKAKIFHYGSISLITEPCRSAHMAAMKTAKEAGVLLSYDPNVRLPLWPSPEAAREGIMSIWNEAEFIKVSDDEVAFLTQKDSSDEEAVKLLWRDHFKLMVVTDGEKGCRYYTKNLKGKVAGYSVKAVDTTGAGD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030325`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030325

Location Chr06:114334571-114340711 (+)

Description Similar to At4g10260: Probable fructokinase-5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g10260`	May play an important role in maintaining the flux of carbon towards starch formation.	No verified direct reference in this release
`At3g59480`	May play an important role in maintaining the flux of carbon towards starch formation.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0113100`	May play an important role in maintaining the flux of carbon towards starch formation in endosperm.	No verified direct reference in this release
`UniProt: A2YQL4`	May play an important role in maintaining the flux of carbon towards starch formation in endosperm.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030325 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006000 fructose metabolic process Biological Process

GO:0019252 starch biosynthetic process Biological Process

GO:0046835 carbohydrate phosphorylation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0008865 fructokinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G59480

ath:AT4G10260

dosa:Os08g0113100

zma:542108

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.623

Rank 1 · LXL04_030325 · OH-1004

Nucleus0.327

Rank 2 · LXL04_030325 · OH-1004

Mitochondrion0.118

Rank 3 · LXL04_030325 · OH-1004

Extracellular0.068

Rank 4 · LXL04_030325 · OH-1004

Cell membrane0.066

Rank 5 · LXL04_030325 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00294.30PfkB4-308 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030325	`PF00294.30`	PfkB	4	308	1e-75	255.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82616`	Arabidopsis thaliana	Probable fructokinase-5	80.192%	Swiss-Prot	strong database homology
`Q9M1B9`	Arabidopsis thaliana	Probable fructokinase-4	67.619%	Swiss-Prot	strong database homology
`Q0J8G4`	Oryza sativa subsp. japonica	Fructokinase-2	77.848%	Swiss-Prot	strong database homology
`A2YQL4`	Oryza sativa subsp. indica	Fructokinase-2	77.848%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card