LXL04_030093 | RubberDandelionOmics

Gene overview

LXL04_030093

Reference: OH-1004 Chr: Chr06 Coordinates: 107432422-107447149 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1230 bp · LXL04_030093|LXL04_030093|OH1004|cDNA

ATGCTCCCGACGCTGCTCCGGAGGCGCTGCTTCTCTTCTCCGCAGTGGACCGCAGCTCCGGCTGGACCTTCTCCTCTAACCTGTTTTACAGGTTCTTCCTATCATCTCGGATCCGCTTCATTCGTTTTCTTAATTTCTACAGAGGCTGCTGCTGATGGCAAACTAAACACGACCATGAATAAAGATGGGAAATCTTCTGTTTATTATGAAGAAGATAGCTCCAGCAAGTTTGGTTTGATCGAGAGAAAAGGAGTTCACTt...

CDS

Download CDS FASTA

1230 bp · LXL04_030093|LXL04_030093|OH1004|CDS

ATGCTCCCGACGCTGCTCCGGAGGCGCTGCTTCTCTTCTCCGCAGTGGACCGCAGCTCCGGCTGGACCTTCTCCTCTAACCTGTTTTACAGGTTCTTCCTATCATCTCGGATCCGCTTCATTCGTTTTCTTAATTTCTACAGAGGCTGCTGCTGATGGCAAACTAAACACGACCATGAATAAAGATGGGAAATCTTCTGTTTATTATGAAGAAGATAGCTCCAGCAAGTTTGGTTTGATCGAGAGAAAAGGAGTTCACTT...

Protein

Download Protein FASTA

409 aa · LXL04_030093|LXL04_030093|OH1004|PROTEIN

MLPTLLRRRCFSSPQWTAAPAGPSPLTCFTGSSYHLGSASFVFLISTEAAADGKLNTTMNKDGKSSVYYEEDSSSKFGLIERKGVHLCLRAGRGFGLQRVPILFLLPGSIFLSRSPLCKTRNLIPAPDFLAQPSPEFLKSNLESSPPVPCAIVSTIADITLLRTLNRRRLLLAQRLPTPVPSPCSAPADAASTSPAPVNCRRRLHLSSIRAPISQLNKQIDKSMIWEGGDNRVLKFPKSGSFEMICHWNMTTMVQLQQTG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030093`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030093

Location Chr06:107432422-107447149 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g26570`	Mediates the incorporation of phosphate into starch-like phospho-alpha-glucan, mostly at the C-3 position of glucose units.	A novel isoform of glucan, water dikinase phosphorylates pre-phosphorylated alpha-glucans and is involved in starch degradation in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2004.02322.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030093 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005982 starch metabolic process Biological Process

GO:0005983 starch catabolic process Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0019200 carbohydrate kinase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0051752 phosphoglucan, water dikinase activity Molecular Function

GO:2001070 starch binding Molecular Function

KEGG gene cross-reference

ath:AT5G26570

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.381

Rank 1 · LXL04_030093 · OH-1004

Cytoplasm0.295

Rank 2 · LXL04_030093 · OH-1004

Cell membrane0.139

Rank 3 · LXL04_030093 · OH-1004

Plastid0.120

Rank 4 · LXL04_030093 · OH-1004

Mitochondrion0.113

Rank 5 · LXL04_030093 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6ZY51`	Arabidopsis thaliana	Phosphoglucan, water dikinase, chloroplastic	61.290%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card