LXL04_029916 | RubberDandelionOmics

Gene overview

LXL04_029916

Reference: OH-1004 Chr: Chr06 Coordinates: 103323326-103325467 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2142 bp · LXL04_029916|LXL04_029916|OH1004|cDNA

ATGGTAGCTAAGAAAGGTGCAAAAGCAGGAGGGGCATCAGAAGATGCTGTAGAGGATTTAGCTCGTGTTCCATTACAAGCCATCCTTTTAGCCGACAGTTTCACCACAAAGTTCCGCCCTATCACCCTCGAATGCCCAAAAGTCCTCTTACCATTAGTCAACACCCCCATGATTGACTACACATTAGCATGGCTGGAATCTGCTGATGTGGAAGAAGTCTTTGTCTTCTGTTGTTCCCACTCCAAACAAATAATCAACTA...

CDS

Download CDS FASTA

2142 bp · LXL04_029916|LXL04_029916|OH1004|CDS

ATGGTAGCTAAGAAAGGTGCAAAAGCAGGAGGGGCATCAGAAGATGCTGTAGAGGATTTAGCTCGTGTTCCATTACAAGCCATCCTTTTAGCCGACAGTTTCACCACAAAGTTCCGCCCTATCACCCTCGAATGCCCAAAAGTCCTCTTACCATTAGTCAACACCCCCATGATTGACTACACATTAGCATGGCTGGAATCTGCTGATGTGGAAGAAGTCTTTGTCTTCTGTTGTTCCCACTCCAAACAAATAATCAACTA...

Protein

Download Protein FASTA

713 aa · LXL04_029916|LXL04_029916|OH1004|PROTEIN

MVAKKGAKAGGASEDAVEDLARVPLQAILLADSFTTKFRPITLECPKVLLPLVNTPMIDYTLAWLESADVEEVFVFCCSHSKQIINYLDKSKWTNQPNFSVTTIESQNCISAGDALRLIYERNVIQGDFILVSGDTVSNMMLTQALQEHKERRKKDNNAVMTMVIKQSKPSQITRQTRLGTDELIMAIDPTTKQLLYYEDKADDSKQTLTLDKSFLSENPSLSLLNDKQDCYIDICSPEVLSLFTDNFDYQHLRRHFVKG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029916`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_029916`
Location	Chr06:103323326-103325467 (+)
Description	Similar to tif225: Probable translation initiation factor eIF-2B subunit epsilon (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029916` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0002183 cytoplasmic translational initiation Biological Process GO:0006413 translational initiation Biological Process GO:0009408 response to heat Biological Process GO:0009749 response to glucose Biological Process GO:0034976 response to endoplasmic reticulum stress Biological Process GO:0043434 response to peptide hormone Biological Process GO:0045727 positive regulation of translation Biological Process GO:0045948 positive regulation of translational initiation Biological Process GO:0050852 T cell receptor signaling pathway Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component
KEGG gene cross-reference	hsa:8893 mmu:224045 ocu:100009393 rno:192234 spo:2542017 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.663

Rank 1 · LXL04_029916 · OH-1004

Nucleus0.389

Rank 2 · LXL04_029916 · OH-1004

Lysosome / Vacuole0.089

Rank 3 · LXL04_029916 · OH-1004

Golgi apparatus0.080

Rank 4 · LXL04_029916 · OH-1004

Cell membrane0.053

Rank 5 · LXL04_029916 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00483.30NTP_transferase27-170 aa

PF25084.2LbH_EIF2B321-425 aa

PF25087.2GMPPB_C334-419 aa

PF00132.31Hexapep342-374 aa

PF24894.2Hexapep_GlmU352-406 aa

PF00132.31Hexapep360-391 aa

PF02020.25W2636-713 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029916	`PF00483.30`	NTP_transferase	27	170	3.3e-12	47.2
LXL04_029916	`PF25084.2`	LbH_EIF2B	321	425	5.4e-37	126.7
LXL04_029916	`PF25087.2`	GMPPB_C	334	419	3.3e-10	40.4
LXL04_029916	`PF00132.31`	Hexapep	342	374	2e-08	34.3
LXL04_029916	`PF24894.2`	Hexapep_GlmU	352	406	8.5e-06	26.6
LXL04_029916	`PF00132.31`	Hexapep	360	391	2e-08	34.3
LXL04_029916	`PF02020.25`	W2	636	713	8.2e-20	71.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card