LXL04_029829 | RubberDandelionOmics

Gene overview

LXL04_029829

Reference: OH-1004 Chr: Chr06 Coordinates: 101365069-101366725 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1050 bp · LXL04_029829|LXL04_029829|OH1004|cDNA

ATGGCTTCAACCAACCCTTTTGATCTTTTGGTTGATGATGACAACGATGACCCCATTCAGCTTCTAGCCAAGCTTCCGGTGGCTGTTCCAACAACGAAAAAAATTCCGGTAGGCGGTGCGGCTGCTAAGCCAGCAGCCAAGCTTCCTTCCAAACCGCTTCCTCCTGCGCAGGCTGTGCGAGAGTCGAGGACTGATGGTCAACGTGGAGGAGGGCGTTTGGGTGGCCGAGGAGCAGGGAGAGGCGGACGTGGCGGCTTCAA...

CDS

Download CDS FASTA

1050 bp · LXL04_029829|LXL04_029829|OH1004|CDS

ATGGCTTCAACCAACCCTTTTGATCTTTTGGTTGATGATGACAACGATGACCCCATTCAGCTTCTAGCCAAGCTTCCGGTGGCTGTTCCAACAACGAAAAAAATTCCGGTAGGCGGTGCGGCTGCTAAGCCAGCAGCCAAGCTTCCTTCCAAACCGCTTCCTCCTGCGCAGGCTGTGCGAGAGTCGAGGACTGATGGTCAACGTGGAGGAGGGCGTTTGGGTGGCCGAGGAGCAGGGAGAGGCGGACGTGGCGGCTTCAA...

Protein

Download Protein FASTA

349 aa · LXL04_029829|LXL04_029829|OH1004|PROTEIN

MASTNPFDLLVDDDNDDPIQLLAKLPVAVPTTKKIPVGGAAAKPAAKLPSKPLPPAQAVRESRTDGQRGGGRLGGRGAGRGGRGGFNRESANDDNSFIPNNGFSGGYRPSENGDGDKATERRGPRMGNRGGRRGGYTNGDATEGERPRRVFERRSGTGRGNDLKREGAGRGNWGTAADDVAPETEEPVAETEKIVDSSEKQENGADATKENAVEVAEEKEPEEKKMTLEEYEKVLEEKRKGLSSLKSEERKVGLDEDLAK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029829`
TK1151 ID	TkA07G351000
OH-1004 ID	LXL04_029829
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029829

Location Chr06:101365069-101366725 (+)

Description Similar to RGGB: RGG repeats nuclear RNA binding protein B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17520`	Ribosome-binding protein that acts as a regulator of mRNA translation by promoting ribosome inactivation (By similarity).	No verified direct reference in this release
`At4g16830`	Ribosome-binding protein that acts as a regulator of mRNA translation by promoting ribosome inactivation (By similarity).	The Arabidopsis RNA-binding protein AtRGGA regulates tolerance to salt and drought stress.2015 · DOI: 10.1104/pp.114.255802
`At5g47210`	Ribosome-binding protein that acts as a regulator of mRNA translation by promoting ribosome inactivation (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029829 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006417 regulation of translation Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009787 regulation of abscisic acid-activated signaling pathway Biological Process

GO:0071470 cellular response to osmotic stress Biological Process

GO:0071472 cellular response to salt stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT4G16830

ath:AT4G17520

ath:AT5G47210

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.793

Rank 1 · LXL04_029829 · OH-1004

Nucleus0.328

Rank 2 · LXL04_029829 · OH-1004

Endoplasmic reticulum0.042

Rank 3 · LXL04_029829 · OH-1004

Cell membrane0.040

Rank 4 · LXL04_029829 · OH-1004

Mitochondrion0.031

Rank 5 · LXL04_029829 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09598.16Stm1_N1-71 aa

PF04774.21HABP4_PAI-RBP1147-252 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029829	`PF09598.16`	Stm1_N	1	71	5.8e-20	72.5
LXL04_029829	`PF04774.21`	HABP4_PAI-RBP1	147	252	4e-26	92.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23593`	Arabidopsis thaliana	RGG repeats nuclear RNA binding protein B	47.594%	Swiss-Prot	moderate database homology
`O23523`	Arabidopsis thaliana	RGG repeats nuclear RNA binding protein A	50.404%	Swiss-Prot	strong database homology
`Q9LVT8`	Arabidopsis thaliana	RGG repeats nuclear RNA binding protein C	49.462%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card