LXL04_029819 | RubberDandelionOmics

Gene overview

LXL04_029819

Reference: OH-1004 Chr: Chr06 Coordinates: 101125370-101125792 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

423 bp · LXL04_029819|LXL04_029819|OH1004|cDNA

ATGGCTAATAATGGTTCAGTCCAACACATCTCCCCGGACCAACAGTTGTACGAAAATCTGGTCAAGATTATCGAACCCTTGATCTATAGTGGCCCCTTCATCGTTATTTCCATTGTTGGTCTGGTCCTCTTCCTCATCCTCACCTTGGTGTTTATTATCTTAAGCCCAATGCTTATCATATTAAGCCCGGTGTTGGTTCCATTCTCCTTCATCTTGTGGATGTGCCTTTACATTACAGGAGAACATCCTGTTGGCGTGTT...

CDS

Download CDS FASTA

423 bp · LXL04_029819|LXL04_029819|OH1004|CDS

ATGGCTAATAATGGTTCAGTCCAACACATCTCCCCGGACCAACAGTTGTACGAAAATCTGGTCAAGATTATCGAACCCTTGATCTATAGTGGCCCCTTCATCGTTATTTCCATTGTTGGTCTGGTCCTCTTCCTCATCCTCACCTTGGTGTTTATTATCTTAAGCCCAATGCTTATCATATTAAGCCCGGTGTTGGTTCCATTCTCCTTCATCTTGTGGATGTGCCTTTACATTACAGGAGAACATCCTGTTGGCGTGTT...

Protein

Download Protein FASTA

140 aa · LXL04_029819|LXL04_029819|OH1004|PROTEIN

MANNGSVQHISPDQQLYENLVKIIEPLIYSGPFIVISIVGLVLFLILTLVFIILSPMLIILSPVLVPFSFILWMCLYITGEHPVGVFVILSPVLAPASFIFWVCLYVTGEHPIGADWVDETLKKIVEVTEDIYVKNKVES

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029819`
TK1151 ID	TkA07G350350
OH-1004 ID	LXL04_029819
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 31.544 / OH-1004 33.571 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029819

Location Chr06:101125370-101125792 (-)

Description Similar to Oleosin Bn-V (Fragment)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g25140`	May have a structural role to stabilize the lipid body during desiccation of the seed by preventing coalescence of the oil.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029819 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009791 post-embryonic development Biological Process

GO:0009845 seed germination Biological Process

GO:0010344 seed oilbody biogenesis Biological Process

GO:0010431 seed maturation Biological Process

GO:0019915 lipid storage Biological Process

GO:0034389 lipid droplet organization Biological Process

GO:0048608 reproductive structure development Biological Process

GO:0050826 response to freezing Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0012511 monolayer-surrounded lipid storage body Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT4G25140

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.349

Rank 1 · LXL04_029819 · OH-1004

Cytoplasm0.178

Rank 2 · LXL04_029819 · OH-1004

Lysosome / Vacuole0.174

Rank 3 · LXL04_029819 · OH-1004

Golgi apparatus0.134

Rank 4 · LXL04_029819 · OH-1004

Extracellular0.097

Rank 5 · LXL04_029819 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P29525`	Arabidopsis thaliana	Oleosin 18.5 kDa	31.868%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card