LXL04_029718 | RubberDandelionOmics

Gene overview

LXL04_029718

Reference: OH-1004 Chr: Chr06 Coordinates: 98330634-98333619 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2328 bp · LXL04_029718|LXL04_029718|OH1004|cDNA

ATGGCGGCAGAATCTGTTGCCGCGGCGTCACTCTGCAACTTCACAGTCAGCAATGGTAGTTCATCAAGCAGGGCGCTCCGTCGCGTCTTTCTCTCTCCCGCCACCTCCCTCCGTCGCCGTAGTCTTACCTCGTCTTTCTTCGGAACCCAACGGCGCACAACAAACATATCGACTTCTCACTTTCAAAAGAGGAACCTTTCAGTCTTCGCCATGGCTGCTGCTCCCGAAGACGGAAAGCGTGGGGTTCCATTGAAGGACTA...

CDS

Download CDS FASTA

2328 bp · LXL04_029718|LXL04_029718|OH1004|CDS

ATGGCGGCAGAATCTGTTGCCGCGGCGTCACTCTGCAACTTCACAGTCAGCAATGGTAGTTCATCAAGCAGGGCGCTCCGTCGCGTCTTTCTCTCTCCCGCCACCTCCCTCCGTCGCCGTAGTCTTACCTCGTCTTTCTTCGGAACCCAACGGCGCACAACAAACATATCGACTTCTCACTTTCAAAAGAGGAACCTTTCAGTCTTCGCCATGGCTGCTGCTCCCGAAGACGGAAAGCGTGGGGTTCCATTGAAGGACTA...

Protein

Download Protein FASTA

775 aa · LXL04_029718|LXL04_029718|OH1004|PROTEIN

MAAESVAAASLCNFTVSNGSSSSRALRRVFLSPATSLRRRSLTSSFFGTQRRTTNISTSHFQKRNLSVFAMAAAPEDGKRGVPLKDYRNIGIMAHIDAGKTTTTERVLYYTGRNYKIGEVHEGTATMDWMEQEQERGITITSAATTTFWNNHRINIIDTPGHVDFTLEVERALRVLDGAICLFDSVAGVEPQSETVWRQADKYGVPRICFVNKMDRLGANFFRTRDMIVTNLGAKPLVLQLPIGSEDIFKGVIDLVKMKA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029718`
TK1151 ID	TkA07G340580
OH-1004 ID	LXL04_029718
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029718

Location Chr06:98330634-98333619 (+)

Description Similar to fusA1: Elongation factor G-1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g62750`	Chloroplast-localized elongation factor EF-G involved in protein synthesis in plastids.	Characterization of the snowy cotyledon 1 mutant of Arabidopsis thaliana: the impact of chloroplast elongation factor G on chloroplast development and plant vitality.2006 · DOI: 10.1007/s11103-005-4921-0 Mutations in a plastid-localized elongation factor G alter early stages of plastid development in Arabidopsis thaliana.2007 · DOI: 10.1186/1471-2229-7-37

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029718 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009658 chloroplast organization Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0009845 seed germination Biological Process

GO:0032790 ribosome disassembly Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0048046 apoplast Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G62750

mag:amb3133

pla:Plav_2733

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.891

Rank 1 · LXL04_029718 · OH-1004

Mitochondrion0.161

Rank 2 · LXL04_029718 · OH-1004

Cytoplasm0.039

Rank 3 · LXL04_029718 · OH-1004

Peroxisome0.018

Rank 4 · LXL04_029718 · OH-1004

Nucleus0.017

Rank 5 · LXL04_029718 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00009.34GTP_EFTU85-358 aa

PF22042.3EF-G_D2386-469 aa

PF03144.32GTP_EFTU_D2401-468 aa

PF14492.13EFG_III481-554 aa

PF16658.12RF3_C490-569 aa

PF03764.25EFG_IV556-674 aa

PF00679.31EFG_C678-764 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029718	`PF00009.34`	GTP_EFTU	85	358	3.1e-67	226.5
LXL04_029718	`PF22042.3`	EF-G_D2	386	469	5.3e-16	59.2
LXL04_029718	`PF03144.32`	GTP_EFTU_D2	401	468	1.3e-16	61.5
LXL04_029718	`PF14492.13`	EFG_III	481	554	7.3e-32	110.0
LXL04_029718	`PF16658.12`	RF3_C	490	569	1.3e-06	29.0
LXL04_029718	`PF03764.25`	EFG_IV	556	674	1.9e-46	157.5
LXL04_029718	`PF00679.31`	EFG_C	678	764	2.8e-26	92.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SI75`	Arabidopsis thaliana	Elongation factor G, chloroplastic	87.603%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card