RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_029562
Reference: OH-1004 Chr: Chr06 Coordinates: 93933567-93939539 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3822 bp · LXL04_029562|LXL04_029562|OH1004|cDNA

ATGGTAGACGGTTCGCTGTATTCACCTCTGCAACCTAATCCACCATCTGAAACAGACGAAAATGTTACTCCGATGGCCAAAGCCGGAATGTTAAGTAAAAGCACATTCTGGTGGCTAAATCCGTTGATGAGAAAAGGAAAAAGTAAAGTTCTCGACGATAAAGACATCCCAAAGTTAAGAAAAGAAGACACATCAGAAGAATGTTACACCAGATTCATGGAGACGCTGGAGAAACGGCGAGCAAAGAGTGTTTCCGGTGG...

CDS

Download CDS FASTA

3822 bp · LXL04_029562|LXL04_029562|OH1004|CDS

ATGGTAGACGGTTCGCTGTATTCACCTCTGCAACCTAATCCACCATCTGAAACAGACGAAAATGTTACTCCGATGGCCAAAGCCGGAATGTTAAGTAAAAGCACATTCTGGTGGCTAAATCCGTTGATGAGAAAAGGAAAAAGTAAAGTTCTCGACGATAAAGACATCCCAAAGTTAAGAAAAGAAGACACATCAGAAGAATGTTACACCAGATTCATGGAGACGCTGGAGAAACGGCGAGCAAAGAGTGTTTCCGGTGG...

Protein

Download Protein FASTA

1273 aa · LXL04_029562|LXL04_029562|OH1004|PROTEIN

MVDGSLYSPLQPNPPSETDENVTPMAKAGMLSKSTFWWLNPLMRKGKSKVLDDKDIPKLRKEDTSEECYTRFMETLEKRRAKSVSGGHGDSDPSLLSTLFVWQWKGLVITGFFALIKVLALASGPLILRAFIQLVQGKESFKNEGYFLTAGLFLAKCLESISERQLKFRSRLIGLQLKSMLCAAIYKKQLRLSNDAKLIYSPGQIMNYATVDANRIGEVPFWFHNVWTIALQICLGILIIYYSIGAATIAALLAIILTVV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_029562
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_029562
LocationChr06:93933567-93939539 (+)
DescriptionSimilar to ABCC10: ABC transporter C family member 10
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g59140 Pump for glutathione S-conjugates. No verified direct reference in this release
At1g04120 Pump for glutathione S-conjugates.
The Arabidopsis thaliana ABC transporter AtMRP5 controls root development and stomata movement.2001 · DOI: 10.1093/emboj/20.8.1875
The plant multidrug resistance ABC transporter AtMRP5 is involved in guard cell hormonal signalling and water use.2003 · DOI: 10.1046/j.1365-313x.2003.016012.x
Binding of sulfonylurea by AtMRP5, an Arabidopsis multidrug resistance-related protein that functions in salt tolerance.2004 · DOI: 10.1104/pp.103.027045
The Arabidopsis ATP-binding cassette protein AtMRP5/AtABCC5 is a high affinity inositol hexakisphosphate transporter involved in guard cell signaling and phytate storage.2009 · DOI: 10.1074/jbc.m109.030247

Rice

Reference gene IDPossible functionPapers / DOI
Os03g0142800 ABC transporter that may affect phytic acid transport and compartmentalization.
Mutations of the multi-drug resistance-associated protein ABC transporter gene 5 result in reduction of phytic acid in rice seeds.2009 · DOI: 10.1007/s00122-009-1018-1
UniProt: A2XCD4 ABC transporter that may affect phytic acid transport and compartmentalization. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_029562 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0009651 response to salt stress Biological Process
GO:0030007 intracellular potassium ion homeostasis Biological Process
GO:0055085 transmembrane transport Biological Process
GO:0000325 plant-type vacuole Cellular Component
GO:0005773 vacuole Cellular Component
GO:0005774 vacuolar membrane Cellular Component
GO:0005829 cytosol Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0016020 membrane Cellular Component
GO:0005524 ATP binding Molecular Function
GO:0008281 sulfonylurea receptor activity Molecular Function
GO:0008559 ABC-type xenobiotic transporter activity Molecular Function
KEGG gene cross-reference
ath:AT1G04120
ath:AT3G59140
dosa:Os03g0142800
zma:100125659
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.384
Rank 1 · LXL04_029562 · OH-1004
Lysosome / Vacuole0.269
Rank 2 · LXL04_029562 · OH-1004
Endoplasmic reticulum0.192
Rank 3 · LXL04_029562 · OH-1004
Cytoplasm0.156
Rank 4 · LXL04_029562 · OH-1004
Golgi apparatus0.102
Rank 5 · LXL04_029562 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00664.29ABC_membrane108-372 aa
PF00005.34ABC_tran438-572 aa
PF00664.29ABC_membrane715-966 aa
PF00005.34ABC_tran1047-1195 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_029562PF00664.29ABC_membrane1083725e-45155.0
LXL04_029562PF00005.34ABC_tran4385728.6e-52176.1
LXL04_029562PF00664.29ABC_membrane7159665e-45155.0
LXL04_029562PF00005.34ABC_tran104711958.6e-52176.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LYS2Arabidopsis thalianaABC transporter C family member 1056.386%Swiss-Protstrong database homology
Q7GB25Arabidopsis thalianaABC transporter C family member 543.357%Swiss-Protmoderate database homology
Q10RX7Oryza sativa subsp. japonicaABC transporter C family member 1344.095%Swiss-Protmoderate database homology
A2XCD4Oryza sativa subsp. indicaABC transporter C family member 1344.095%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser