LXL04_028984 | RubberDandelionOmics

Gene overview

LXL04_028984

Reference: OH-1004 Chr: Chr06 Coordinates: 76916637-76922110 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4761 bp · LXL04_028984|LXL04_028984|OH1004|cDNA

ATGGCGGAGATTGGTCAAGAATCGGTGGATTTTTCGACTCTGGTGAGTCGAACTGCAGAGGAATCATACCTTTCTTTGAAGGAATTGGTGGAGAAGTCGAAATCTTCTGAAATGTCGGATTCCGAAAAGAAGATTAGCATACTCAAGTATCTCGTTAAGACTCAGCAGCGTATGCTCCGACTCAATGTTCTTGCGCAGTGGTGCCAGCAGGTACCACTGATACAATATTGTCAGCAACTTGCATCAACCCTATCAAGTCA...

CDS

Download CDS FASTA

4761 bp · LXL04_028984|LXL04_028984|OH1004|CDS

ATGGCGGAGATTGGTCAAGAATCGGTGGATTTTTCGACTCTGGTGAGTCGAACTGCAGAGGAATCATACCTTTCTTTGAAGGAATTGGTGGAGAAGTCGAAATCTTCTGAAATGTCGGATTCCGAAAAGAAGATTAGCATACTCAAGTATCTCGTTAAGACTCAGCAGCGTATGCTCCGACTCAATGTTCTTGCGCAGTGGTGCCAGCAGGTACCACTGATACAATATTGTCAGCAACTTGCATCAACCCTATCAAGTCA...

Protein

Download Protein FASTA

1586 aa · LXL04_028984|LXL04_028984|OH1004|PROTEIN

MAEIGQESVDFSTLVSRTAEESYLSLKELVEKSKSSEMSDSEKKISILKYLVKTQQRMLRLNVLAQWCQQVPLIQYCQQLASTLSSHETCFTQAADSMFFMHEGLQQARAPIYDVPSAIEILLTGTYQRLPKCTEDVGIQTTLTDKQQKPVLKKLDTIVRSKLLETPLPKEFTEVKIFDGTVHLYVEGEFKVLLTLGYRGHLSMWRILHLEVLVGERTGLVKLEEMRRFVLGDDLERRMAASDTPFATLYSILHEFCVAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028984`
TK1151 ID	TkA07G258000
OH-1004 ID	LXL04_028984
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.100
Protein coverage (%)	TK1151 91.340 / OH-1004 27.932 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028984

Location Chr06:76916637-76922110 (+)

Description Similar to MED14: Mediator of RNA polymerase II transcription subunit 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g04740`	Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes.	The transcription corepressor LEUNIG interacts with the histone deacetylase HDA19 and mediator components MED14 (SWP) and CDK8 (HEN3) to repress transcription.2007 · DOI: 10.1128/mcb.01912-06 PHYTOCHROME-INTERACTING FACTOR 4/HEMERA-mediated thermosensory growth requires the Mediator subunit MED14.2022 · DOI: 10.1093/plphys/kiac412

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028984 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0009266 response to temperature stimulus Biological Process

GO:0009627 systemic acquired resistance Biological Process

GO:0009631 cold acclimation Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0019827 stem cell population maintenance Biological Process

GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0051123 RNA polymerase II preinitiation complex assembly Biological Process

KEGG gene cross-reference

ath:AT3G04740

cel:CELE_C38C10.5

ddi:DDB_G0291297

hsa:9282

mmu:26896

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.863

Rank 1 · LXL04_028984 · OH-1004

Cytoplasm0.189

Rank 2 · LXL04_028984 · OH-1004

Mitochondrion0.030

Rank 3 · LXL04_028984 · OH-1004

Cell membrane0.030

Rank 4 · LXL04_028984 · OH-1004

Golgi apparatus0.023

Rank 5 · LXL04_028984 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08638.17Med149-197 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028984	`PF08638.17`	Med14	9	197	1.9e-55	188.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SR02`	Arabidopsis thaliana	Mediator of RNA polymerase II transcription subunit 14	62.733%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card