LXL04_028818 | RubberDandelionOmics

Gene overview

LXL04_028818

Reference: OH-1004 Chr: Chr06 Coordinates: 66510748-66513175 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1428 bp · LXL04_028818|LXL04_028818|OH1004|cDNA

ATGGATGCAGTGACAAGCTCACATGCTCTCTCCGGTATAAATATCTTAAAATCGAACGCCTCCAAATTCAGACACGATTCTTCTGTGCATGCATGTGGAATAAGACATGGATCATCTAGTACAAGCGAAAGAGCATTTCAGAAGTTGAAGTTGCAGAATAACACAAGTGTAGGTGGAAAAAGGTCGAGTTCTACAGCAGTGTGGACACATCCTTTAAGTCCTATTTCAGACATTGAAGAGGATAAGGTTGGAGTACTTGT...

CDS

Download CDS FASTA

1428 bp · LXL04_028818|LXL04_028818|OH1004|CDS

ATGGATGCAGTGACAAGCTCACATGCTCTCTCCGGTATAAATATCTTAAAATCGAACGCCTCCAAATTCAGACACGATTCTTCTGTGCATGCATGTGGAATAAGACATGGATCATCTAGTACAAGCGAAAGAGCATTTCAGAAGTTGAAGTTGCAGAATAACACAAGTGTAGGTGGAAAAAGGTCGAGTTCTACAGCAGTGTGGACACATCCTTTAAGTCCTATTTCAGACATTGAAGAGGATAAGGTTGGAGTACTTGT...

Protein

Download Protein FASTA

475 aa · LXL04_028818|LXL04_028818|OH1004|PROTEIN

MDAVTSSHALSGINILKSNASKFRHDSSVHACGIRHGSSSTSERAFQKLKLQNNTSVGGKRSSSTAVWTHPLSPISDIEEDKVGVLVLNLGGPETLNDVQPFLYNLFADPDIIRLPRLFRFLQRPLAQVISTVRAPKSKQGYASIGGGSPLRKITDEQADALKIALQGKGVAANVYVAMRYWHPFTEEAVEQIKRDGITKLVVLPLYPQFSISTTGSSIRLLQRLFREDKILSTLPVAIIQSWYQRQGYLNSMADLIQKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028818`
TK1151 ID	TkA07G226650
OH-1004 ID	LXL04_028818
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.781 / OH-1004 95.789 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028818

Location Chr06:66510748-66513175 (+)

Description Similar to HEMH: Ferrochelatase-2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g26030`	Catalyzes the last step of heme biosynthesis by inserting ferrous iron into protoporphyrin IX to produce protoheme.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0297000`	Catalyzes the ferrous insertion into protoporphyrin IX.	No verified direct reference in this release
`UniProt: A2Y3Q5`	Catalyzes the ferrous insertion into protoporphyrin IX.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028818 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006783 heme biosynthetic process Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0033014 tetrapyrrole biosynthetic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0004325 ferrochelatase activity Molecular Function

KEGG gene cross-reference

ath:AT5G26030

csv:101216568

dosa:Os09g0297000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.965

Rank 1 · LXL04_028818 · OH-1004

Mitochondrion0.054

Rank 2 · LXL04_028818 · OH-1004

Cytoplasm0.023

Rank 3 · LXL04_028818 · OH-1004

Nucleus0.018

Rank 4 · LXL04_028818 · OH-1004

Cell membrane0.013

Rank 5 · LXL04_028818 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00762.25Ferrochelatase82-405 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028818	`PF00762.25`	Ferrochelatase	82	405	2.4e-111	372.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P42043`	Arabidopsis thaliana	Ferrochelatase-1, chloroplastic/mitochondrial	74.667%	Swiss-Prot	strong database homology
`Q69TB1`	Oryza sativa subsp. japonica	Ferrochelatase-1, chloroplastic	69.451%	Swiss-Prot	strong database homology
`A2Y3Q5`	Oryza sativa subsp. indica	Ferrochelatase-2, chloroplastic	69.231%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card