LXL04_028527 | RubberDandelionOmics

Gene overview

LXL04_028527

Reference: OH-1004 Chr: Chr06 Coordinates: 44520888-44523656 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

693 bp · LXL04_028527|LXL04_028527|OH1004|cDNA

ATGAAAATTAACTCGGAAGGAGAGGGCGATGTTGGTGGTGGTCACCGGATTTTTCCGTTGCCTCAACCGGAGACAATAGTGACTAACAACGGACGATTAGGAGGACGAGTAGAAGCTGAAAGTATCTACGGAACCACTGGAGGAGCGACAAAGTTGATGAGGGTCATAGAAGAAGAGTATAATTCGTCTGGTAGTTCGTCGATCGGTAAGAATAGCGACGACGACGACGACGATCAGGAAGGAGATGCTCAGAGTTCTTA...

CDS

Download CDS FASTA

693 bp · LXL04_028527|LXL04_028527|OH1004|CDS

ATGAAAATTAACTCGGAAGGAGAGGGCGATGTTGGTGGTGGTCACCGGATTTTTCCGTTGCCTCAACCGGAGACAATAGTGACTAACAACGGACGATTAGGAGGACGAGTAGAAGCTGAAAGTATCTACGGAACCACTGGAGGAGCGACAAAGTTGATGAGGGTCATAGAAGAAGAGTATAATTCGTCTGGTAGTTCGTCGATCGGTAAGAATAGCGACGACGACGACGACGATCAGGAAGGAGATGCTCAGAGTTCTTA...

Protein

Download Protein FASTA

230 aa · LXL04_028527|LXL04_028527|OH1004|PROTEIN

MKINSEGEGDVGGGHRIFPLPQPETIVTNNGRLGGRVEAESIYGTTGGATKLMRVIEEEYNSSGSSSIGKNSDDDDDDQEGDAQSSYRYHQNNNKISNGSLDDAIQALEEALPIRRGISTFYNGKSKSFTCLTKMWPSSTPSIQEIVKPDNVYTRKRRNLLASTILSPKNKNHTTFQLSGISVGRISKKTKTSTLRFTSENKDLDLKKSSMRSVSMVHLHRYGSRFIQNC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028527`
TK1151 ID	TkAUNG053680
OH-1004 ID	LXL04_028527
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	98.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028527

Location Chr06:44520888-44523656 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g43850`	Protein OXIDATIVE STRESS 3 LIKE 2.	No verified direct reference in this release
`At5g21940`	Promotes slightly the tolerance to zinc (Zn) and to oxidizing chemicals (e.g. diamide).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028527 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006979 response to oxidative stress Biological Process

GO:0010043 response to zinc ion Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0016301 kinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G43850

ath:AT5G21940

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.720

Rank 1 · LXL04_028527 · OH-1004

Cytoplasm0.311

Rank 2 · LXL04_028527 · OH-1004

Cell membrane0.069

Rank 3 · LXL04_028527 · OH-1004

Endoplasmic reticulum0.040

Rank 4 · LXL04_028527 · OH-1004

Plastid0.031

Rank 5 · LXL04_028527 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30470.1OXS358-188 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028527	`PF30470.1`	OXS3	58	188	1.7e-29	103.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A0A1I9LQ12`	Arabidopsis thaliana	Protein OXIDATIVE STRESS 3 LIKE 2	49.000%	Swiss-Prot	weak database homology
`Q9C593`	Arabidopsis thaliana	Protein OXIDATIVE STRESS 3 LIKE 1	35.766%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card