LXL04_028405 | RubberDandelionOmics

Gene overview

LXL04_028405

Reference: OH-1004 Chr: Chr06 Coordinates: 40581265-40583928 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1263 bp · LXL04_028405|LXL04_028405|OH1004|cDNA

ATGTCATCTTGTTTAAGTGGAGGTACAGGAAGAGCTTATGGATTTGATATCGAAAATATTGTGAAATGTCCATCAACAACCTCTAGTAGAACTTCACATTCAtcttctccatcttcaactcTCTCTGAATCAAGCAATTCCCCGATTGCAATCTCCCATCGGAAGCCTCGAACTCCTCGTAAAAGACCCAATCAAACTTACAATGAAGCAGCTGTTCTTCTTTCGATTGCTTGTCCCAAAGTTTtttcaaccaaaaacct...

CDS

Download CDS FASTA

1263 bp · LXL04_028405|LXL04_028405|OH1004|CDS

ATGTCATCTTGTTTAAGTGGAGGTACAGGAAGAGCTTATGGATTTGATATCGAAAATATTGTGAAATGTCCATCAACAACCTCTAGTAGAACTTCACATTCATCTTCTCCATCTTCAACTCTCTCTGAATCAAGCAATTCCCCGATTGCAATCTCCCATCGGAAGCCTCGAACTCCTCGTAAAAGACCCAATCAAACTTACAATGAAGCAGCTGTTCTTCTTTCGATTGCTTGTCCCAAAGTTTTTTCAACCAAAAACCT...

Protein

Download Protein FASTA

420 aa · LXL04_028405|LXL04_028405|OH1004|PROTEIN

MSSCLSGGTGRAYGFDIENIVKCPSTTSSRTSHSSSPSSTLSESSNSPIAISHRKPRTPRKRPNQTYNEAAVLLSIACPKVFSTKNLTKKNNNLSKFTRQNGNSLHEPPELLLPFPMIKNSGFLFHQPILEKPSSLFDSKVANSCQSPREVEYRNCNSGSNSMELCDGYEDDFDTESMLDEEIEEGIDSIMGSSNSAIQNYKSTDNSCLNSKTCYGYPMGLGFGGNLEFNFGFGMRNGVRALKNGDDGNWWNFPAVNVVN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028405`
TK1151 ID	TkA07G152220
OH-1004 ID	LXL04_028405
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028405

Location Chr06:40581265-40583928 (+)

Description Similar to CIA2: Protein CHLOROPLAST IMPORT APPARATUS 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g57180`	Responsible for specific up-regulation of the translocon genes TOC33 and TOC75 in leaves.	CIA2 coordinately up-regulates protein import and synthesis in leaf chloroplasts.2009 · DOI: 10.1104/pp.109.137240
`At1g25440`	Zinc finger protein CONSTANS-LIKE 16.	No verified direct reference in this release
`At1g68520`	Zinc finger protein CONSTANS-LIKE 6.	No verified direct reference in this release
`At1g73870`	Zinc finger protein CONSTANS-LIKE 7.	No verified direct reference in this release
`At1g49130`	Zinc finger protein CONSTANS-LIKE 8.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028405 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009408 response to heat Biological Process

GO:0009641 shade avoidance Biological Process

GO:0010223 secondary shoot formation Biological Process

GO:0045036 protein targeting to chloroplast Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G25440

ath:AT1G49130

ath:AT1G68520

ath:AT1G73870

ath:AT5G57180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.665

Rank 1 · LXL04_028405 · OH-1004

Cytoplasm0.343

Rank 2 · LXL04_028405 · OH-1004

Cell membrane0.104

Rank 3 · LXL04_028405 · OH-1004

Endoplasmic reticulum0.052

Rank 4 · LXL04_028405 · OH-1004

Plastid0.021

Rank 5 · LXL04_028405 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06203.20CCT369-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028405	`PF06203.20`	CCT	369	411	5.1e-17	62.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LU68`	Arabidopsis thaliana	Protein CHLOROPLAST IMPORT APPARATUS 2	44.201%	Swiss-Prot	moderate database homology
`Q8RWD0`	Arabidopsis thaliana	Zinc finger protein CONSTANS-LIKE 16	44.681%	Swiss-Prot	weak database homology
`Q8LG76`	Arabidopsis thaliana	Zinc finger protein CONSTANS-LIKE 6	45.536%	Swiss-Prot	weak database homology
`Q9C9A9`	Arabidopsis thaliana	Zinc finger protein CONSTANS-LIKE 7	45.690%	Swiss-Prot	weak database homology
`Q9M9B3`	Arabidopsis thaliana	Zinc finger protein CONSTANS-LIKE 8	47.253%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card