LXL04_027799 | RubberDandelionOmics

Gene overview

LXL04_027799

Reference: OH-1004 Chr: Chr06 Coordinates: 24113678-24116517 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2436 bp · LXL04_027799|LXL04_027799|OH1004|cDNA

ATGCCGGTTCTAAGGTCAAGAAAAGTTGATTCTGTAACTCAGAACGAACAATCGCATAAACCCCTTATAAATGGGGATCAAATCGAACCACCAACACCGGCAAAGGAAGTCGAGTCAACGACAAAACCGTCACATGAAAGGACCCCGAGTCCATACAACTTGGTTCACAGTTCCGATAAGACAGGGTCAGTCGGTAGTATAGACTCCGAGTCTGTTTCGAACATACCTCTGAGAAGGAGTGCACGACTTTCCTCGAAGTC...

CDS

Download CDS FASTA

2436 bp · LXL04_027799|LXL04_027799|OH1004|CDS

ATGCCGGTTCTAAGGTCAAGAAAAGTTGATTCTGTAACTCAGAACGAACAATCGCATAAACCCCTTATAAATGGGGATCAAATCGAACCACCAACACCGGCAAAGGAAGTCGAGTCAACGACAAAACCGTCACATGAAAGGACCCCGAGTCCATACAACTTGGTTCACAGTTCCGATAAGACAGGGTCAGTCGGTAGTATAGACTCCGAGTCTGTTTCGAACATACCTCTGAGAAGGAGTGCACGACTTTCCTCGAAGTC...

Protein

Download Protein FASTA

811 aa · LXL04_027799|LXL04_027799|OH1004|PROTEIN

MPVLRSRKVDSVTQNEQSHKPLINGDQIEPPTPAKEVESTTKPSHERTPSPYNLVHSSDKTGSVGSIDSESVSNIPLRRSARLSSKSSSYNVVENVGSRRKRKNVNSSVQVSASGIEKESGGSKDDVIDVRDSNGYDREDTLNVQKVKNQRLLSHDICFLSSESVQECDLGNKTLSLRSGKKLLKPEIENVAIEQELSPYQKDEKETEEGNSDTVVHEATQVTESLTFEAEEGSSGTKNDGEKTRKRFSTEDKQKGVMVD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027799`
TK1151 ID	TkA07G094560
OH-1004 ID	LXL04_027799
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027799

Location Chr06:24113678-24116517 (-)

Description Similar to rhp7: DNA repair protein rhp7 (Schizosaccharomyces pombe (strain 972 / ATCC 24843)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58530`	F-box protein At3g58530.	No verified direct reference in this release
`At1g21410`	Component of SCF(SKP2A) E3 ubiquitin ligase complexes, which mediate the ubiquitination and subsequent proteasomal degradation of target proteins (including cell cycle repressors).	The balance between cell division and endoreplication depends on E2FC-DPB, transcription factors regulated by the ubiquitin-SCFSKP2A pathway in Arabidopsis.2006 · DOI: 10.1105/tpc.105.039651 SKP2A protein, an F-box that regulates cell division, is degraded via the ubiquitin pathway.2008 · DOI: 10.4161/psb.3.10.5888 The Arabidopsis cell cycle F-box protein SKP2A binds to auxin.2010 · DOI: 10.1105/tpc.110.078972
`At1g77000`	Component of SCF(SKP2B) E3 ubiquitin ligase complexes, which mediate the ubiquitination and subsequent proteasomal degradation of the cyclin-dependent kinase inhibitor KRP1.	Degradation of the cyclin-dependent kinase inhibitor KRP1 is regulated by two different ubiquitin E3 ligases.2008 · DOI: 10.1111/j.1365-313x.2007.03370.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027799 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0003341 cilium movement Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010311 lateral root formation Biological Process

GO:0010824 regulation of centrosome duplication Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0030317 flagellated sperm motility Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0051781 positive regulation of cell division Biological Process

GO:0071365 cellular response to auxin stimulus Biological Process

GO:0000113 nucleotide-excision repair factor 4 complex Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G21410

ath:AT3G58530

hsa:222235

spo:2539094

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.935

Rank 1 · LXL04_027799 · OH-1004

Cytoplasm0.097

Rank 2 · LXL04_027799 · OH-1004

Cell membrane0.029

Rank 3 · LXL04_027799 · OH-1004

Plastid0.015

Rank 4 · LXL04_027799 · OH-1004

Mitochondrion0.014

Rank 5 · LXL04_027799 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25372.2LRR_FBXL15457-579 aa

PF25372.2LRR_FBXL15661-779 aa

PF29594.1LRR_SKP2680-769 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027799	`PF25372.2`	LRR_FBXL15	457	579	1e-12	48.0
LXL04_027799	`PF25372.2`	LRR_FBXL15	661	779	1e-12	48.0
LXL04_027799	`PF29594.1`	LRR_SKP2	680	769	6.7e-10	39.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LB33`	Arabidopsis thaliana	F-box protein At3g58530	33.149%	Swiss-Prot	weak database homology
`Q9LPL4`	Arabidopsis thaliana	F-box protein SKP2A	36.095%	Swiss-Prot	weak database homology
`O49286`	Arabidopsis thaliana	F-box protein SKP2B	34.392%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card