LXL04_027768 | RubberDandelionOmics

Gene overview

LXL04_027768

Reference: OH-1004 Chr: Chr06 Coordinates: 23705657-23708307 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1719 bp · LXL04_027768|LXL04_027768|OH1004|cDNA

ATGAGTggttcttcatcttcatcctctctctctcattttTGGGCTTCAGCGCTCAGATCTAAACCACTACGTAAATCATCCGACGTCATCAACACTGGCACAGGTGAAGGTCTGGTACGCCGTCTTGGACCTTTTGACTTGCTTTTATTAGGCATTGGCGCTTCTATTGGTGCCGGTATCTTCGTCGTCACCGGCACCATCGCTCGCGATGCTGGTCCTGGAGTTACAATCAGCTTCCTACTAGCAGGAGCATCATGTGT...

CDS

Download CDS FASTA

1719 bp · LXL04_027768|LXL04_027768|OH1004|CDS

ATGAGTGGTTCTTCATCTTCATCCTCTCTCTCTCATTTTTGGGCTTCAGCGCTCAGATCTAAACCACTACGTAAATCATCCGACGTCATCAACACTGGCACAGGTGAAGGTCTGGTACGCCGTCTTGGACCTTTTGACTTGCTTTTATTAGGCATTGGCGCTTCTATTGGTGCCGGTATCTTCGTCGTCACCGGCACCATCGCTCGCGATGCTGGTCCTGGAGTTACAATCAGCTTCCTACTAGCAGGAGCATCATGTGT...

Protein

Download Protein FASTA

572 aa · LXL04_027768|LXL04_027768|OH1004|PROTEIN

MSGSSSSSSLSHFWASALRSKPLRKSSDVINTGTGEGLVRRLGPFDLLLLGIGASIGAGIFVVTGTIARDAGPGVTISFLLAGASCVLNALCYAELASRFPAVVGGAYLYTYTTFNELTAFLVFTQMMLDYHIGAASIARSLSSYIVNILELIPSVKDNIPNWVGHGSDDIFGFLSFNILAPILLVLLTVILCRGVGESTLVNTVMTMTKVTIVFVVIIVGAFEVDDSNWSPFAPTGFKSILTGATVAFFAYVGFDAVAN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027768`
TK1151 ID	TkA07G093260
OH-1004 ID	LXL04_027768
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	93.400
Protein coverage (%)	TK1151 100.000 / OH-1004 49.650 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027768

Location Chr06:23705657-23708307 (+)

Description Similar to CAT9: Cationic amino acid transporter 9, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g05940`	Permease involved in the transport of the cationic amino acids.	No verified direct reference in this release
`At3g03720`	Permease involved in the transport of the cationic amino acids.	No verified direct reference in this release
`At1g58030`	Permease involved in the transport of the cationic amino acids.	No verified direct reference in this release
`At5g36940`	Permease involved in the transport of the cationic neutral or acidic amino acids.	Molecular and functional characterization of a family of amino acid transporters from Arabidopsis.2004 · DOI: 10.1104/pp.104.045278

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027768 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006865 amino acid transport Biological Process

GO:0080144 intracellular amino acid homeostasis Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0015171 amino acid transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G05940

ath:AT1G58030

ath:AT3G03720

ath:AT5G36940

bsu:BSU07340

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.403

Rank 1 · LXL04_027768 · OH-1004

Cell membrane0.275

Rank 2 · LXL04_027768 · OH-1004

Endoplasmic reticulum0.171

Rank 3 · LXL04_027768 · OH-1004

Cytoplasm0.114

Rank 4 · LXL04_027768 · OH-1004

Golgi apparatus0.103

Rank 5 · LXL04_027768 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13520.13AA_permease_242-456 aa

PF00324.28AA_permease47-488 aa

PF13906.13AA_permease_C503-552 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027768	`PF13520.13`	AA_permease_2	42	456	8.8e-47	160.7
LXL04_027768	`PF00324.28`	AA_permease	47	488	7.9e-34	117.9
LXL04_027768	`PF13906.13`	AA_permease_C	503	552	4e-16	59.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C5D6`	Arabidopsis thaliana	Cationic amino acid transporter 9, chloroplastic	64.991%	Swiss-Prot	strong database homology
`Q8W4K3`	Arabidopsis thaliana	Cationic amino acid transporter 4, vacuolar	30.537%	Swiss-Prot	moderate database homology
`Q9ASS7`	Arabidopsis thaliana	Cationic amino acid transporter 2, vacuolar	31.188%	Swiss-Prot	moderate database homology
`Q8GYB4`	Arabidopsis thaliana	Cationic amino acid transporter 3, mitochondrial	32.226%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card