LXL04_027648 | RubberDandelionOmics

Gene overview

LXL04_027648

Reference: OH-1004 Chr: Chr06 Coordinates: 21005749-21006936 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

906 bp · LXL04_027648|LXL04_027648|OH1004|cDNA

ATGGAGAAATCATTGAGGTGTCCAGGATTCCGGTTTAAACCTACCGATGTTGAGTTGGCTATGTATTACCTCAAGAAGAAATTATCGGGGAAAAAACTCTCGCTGGAAGTTATCTCAGAGATTAATATATACGACTTCAGTCCATGGGATCTTCCAGCCAAATCCATATTGAGCGGAGATCTGGAGTGGTACTTCTTCTGCCCACAATCAAAAAAGTATTCAAGTGGGTCCAGAAAGAACCGTGCAACTGAATCCGGTTA...

CDS

Download CDS FASTA

906 bp · LXL04_027648|LXL04_027648|OH1004|CDS

ATGGAGAAATCATTGAGGTGTCCAGGATTCCGGTTTAAACCTACCGATGTTGAGTTGGCTATGTATTACCTCAAGAAGAAATTATCGGGGAAAAAACTCTCGCTGGAAGTTATCTCAGAGATTAATATATACGACTTCAGTCCATGGGATCTTCCAGCCAAATCCATATTGAGCGGAGATCTGGAGTGGTACTTCTTCTGCCCACAATCAAAAAAGTATTCAAGTGGGTCCAGAAAGAACCGTGCAACTGAATCCGGTTA...

Protein

Download Protein FASTA

301 aa · LXL04_027648|LXL04_027648|OH1004|PROTEIN

MEKSLRCPGFRFKPTDVELAMYYLKKKLSGKKLSLEVISEINIYDFSPWDLPAKSILSGDLEWYFFCPQSKKYSSGSRKNRATESGYWKSTGKDRGVKYNERTVATIKTLVFHLGHPPKGTRTNWVMHEYRMNDDNLAKKGVAQDAYVICKVFEKSGLGPKNGAQYGAPFEEEEWEDDETWANPNNASCSGVKNMTSTEPGPSTVTSCQNERLIDTPFNPDDMLTLSDITSLHQNNNIQDVENGKGKEVISDDGVDIFKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027648`
TK1151 ID	TkA07G082990
OH-1004 ID	LXL04_027648
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027648

Location Chr06:21005749-21006936 (+)

Description Similar to NAC082: NAC domain-containing protein 82

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g09330`	Transcriptional regulator that binds specific DNA sequences on the promoter regions of target genes.	No verified direct reference in this release
`At5g04410`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP) (By similarity).	No verified direct reference in this release
`At1g34190`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP).	A membrane-bound NAC transcription factor, ANAC017, mediates mitochondrial retrograde signaling in Arabidopsis.2013 · DOI: 10.1105/tpc.113.113985
`At3g10500`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP).	A NAC transcription factor NTL4 promotes reactive oxygen species production during drought-induced leaf senescence in Arabidopsis.2012 · DOI: 10.1111/j.1365-313x.2012.04932.x The Arabidopsis NAC transcription factor NTL4 participates in a positive feedback loop that induces programmed cell death under heat stress conditions.2014 · DOI: 10.1016/j.plantsci.2014.07.003
`At1g34180`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP) (By similarity).	Mutation of the Arabidopsis NAC016 transcription factor delays leaf senescence.2013 · DOI: 10.1093/pcp/pct113

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027648 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009644 response to high light intensity Biological Process

GO:0009819 drought recovery Biological Process

GO:0009962 regulation of flavonoid biosynthetic process Biological Process

GO:0010150 leaf senescence Biological Process

GO:0031930 mitochondria-nucleus signaling pathway Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0070301 cellular response to hydrogen peroxide Biological Process

GO:1900057 positive regulation of leaf senescence Biological Process

GO:2000377 regulation of reactive oxygen species metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G34180

ath:AT1G34190

ath:AT3G10500

ath:AT5G04410

ath:AT5G09330

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.960

Rank 1 · LXL04_027648 · OH-1004

Cytoplasm0.100

Rank 2 · LXL04_027648 · OH-1004

Cell membrane0.040

Rank 3 · LXL04_027648 · OH-1004

Endoplasmic reticulum0.032

Rank 4 · LXL04_027648 · OH-1004

Plastid0.013

Rank 5 · LXL04_027648 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365.21NAM8-132 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027648	`PF02365.21`	NAM	8	132	2.2e-43	148.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FY82`	Arabidopsis thaliana	NAC domain-containing protein 82	58.031%	Swiss-Prot	moderate database homology
`Q84K00`	Arabidopsis thaliana	NAC domain-containing protein 78	61.272%	Swiss-Prot	moderate database homology
`Q9XIC5`	Arabidopsis thaliana	NAC domain-containing protein 17	47.162%	Swiss-Prot	moderate database homology
`Q949N0`	Arabidopsis thaliana	NAC domain-containing protein 53	59.394%	Swiss-Prot	moderate database homology
`A4FVP6`	Arabidopsis thaliana	NAC domain-containing protein 16	50.857%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card