LXL04_027514 | RubberDandelionOmics

Gene overview

LXL04_027514

Reference: OH-1004 Chr: Chr06 Coordinates: 17780440-17782115 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

396 bp · LXL04_027514|LXL04_027514|OH1004|cDNA

aTGGGTAGGAATTGCAATTTGGAACTCCGCCTTGTGCCGCCGTCACCGTACATTTTCTCCGATCACAACCATCAGTGTCAAGAAAAAACAAGTGAGGAGAATACGGCGGTTGGCGAGGATTTAAAGGATATGCAGAAGCTAACAATCTTTTACGACGGAAAAGTCAGCGTTTGTGACGTCACAGAGCTTCAGGCAAGAACAATAATAAAGCTAGCAAGCGAAGAAATAGAGGAGAAATGGAGGAGAACACCGGGATTAAC...

CDS

Download CDS FASTA

396 bp · LXL04_027514|LXL04_027514|OH1004|CDS

ATGGGTAGGAATTGCAATTTGGAACTCCGCCTTGTGCCGCCGTCACCGTACATTTTCTCCGATCACAACCATCAGTGTCAAGAAAAAACAAGTGAGGAGAATACGGCGGTTGGCGAGGATTTAAAGGATATGCAGAAGCTAACAATCTTTTACGACGGAAAAGTCAGCGTTTGTGACGTCACAGAGCTTCAGGCAAGAACAATAATAAAGCTAGCAAGCGAAGAAATAGAGGAGAAATGGAGGAGAACACCGGGATTAAC...

Protein

Download Protein FASTA

131 aa · LXL04_027514|LXL04_027514|OH1004|PROTEIN

MGRNCNLELRLVPPSPYIFSDHNHQCQEKTSEENTAVGEDLKDMQKLTIFYDGKVSVCDVTELQARTIIKLASEEIEEKWRRTPGLTTSLESPSPLILPPMYSPSGLSMKRSLQRFLQKRKNRMQATSPYH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027514`
TK1151 ID	TkA07G069770
OH-1004 ID	LXL04_027514
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027514

Location Chr06:17780440-17782115 (-)

Description Similar to TIFY5A: Protein TIFY 5A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g30135`	Repressor of jasmonate responses.	JAZ8 lacks a canonical degron and has an EAR motif that mediates transcriptional repression of jasmonate responses in Arabidopsis.2012 · DOI: 10.1105/tpc.111.093005
`At2g34600`	Repressor of jasmonate responses.	No verified direct reference in this release
`At5g13220`	Repressor of jasmonate (JA) responses that lacks the entire Jas domain and possesses severe JA insensitivity and resistance to JA-induced degradation.	A downstream mediator in the growth repression limb of the jasmonate pathway.2007 · DOI: 10.1105/tpc.107.050708 A critical role for the TIFY motif in repression of jasmonate signaling by a stabilized splice variant of the JASMONATE ZIM-domain protein JAZ10 in Arabidopsis.2009 · DOI: 10.1105/tpc.108.064097 Negative feedback control of jasmonate signaling by an alternative splice variant of JAZ10.2013 · DOI: 10.1104/pp.113.218164
`At3g22275`	Non-TIFY functional repressor of jasmonate (JA)-mediated growth and defense responses.	Repression of jasmonate signaling by a non-TIFY JAZ protein in Arabidopsis.2015 · DOI: 10.1111/tpj.12841

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2Z1N3`	Repressor of jasmonate (JA) responses.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027514 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009611 response to wounding Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0010112 regulation of systemic acquired resistance Biological Process

GO:0031347 regulation of defense response Biological Process

GO:2000022 regulation of jasmonic acid mediated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0003714 transcription corepressor activity Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

KEGG gene cross-reference

ath:AT1G30135

ath:AT2G34600

ath:AT3G22275

ath:AT5G13220

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.906

Rank 1 · LXL04_027514 · OH-1004

Cytoplasm0.147

Rank 2 · LXL04_027514 · OH-1004

Cell membrane0.052

Rank 3 · LXL04_027514 · OH-1004

Endoplasmic reticulum0.039

Rank 4 · LXL04_027514 · OH-1004

Plastid0.020

Rank 5 · LXL04_027514 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06200.20tify45-73 aa

PF09425.16Jas_motif110-130 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027514	`PF06200.20`	tify	45	73	1.4e-11	44.2
LXL04_027514	`PF09425.16`	Jas_motif	110	130	2e-10	41.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LBM2`	Arabidopsis thaliana	Protein TIFY 5A	43.165%	Swiss-Prot	moderate database homology
`O64687`	Arabidopsis thaliana	Protein TIFY 5B	38.806%	Swiss-Prot	moderate database homology
`Q93ZM9`	Arabidopsis thaliana	Protein TIFY 9	36.842%	Swiss-Prot	moderate database homology
`F4J078`	Arabidopsis thaliana	Protein JAZ13	32.258%	Swiss-Prot	moderate database homology
`A2Z1N3`	Oryza sativa subsp. indica	Protein TIFY 10c	33.333%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card