Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1272 bp · LXL04_027190|LXL04_027190|OH1004|cDNA
ATGGGGCAGCAGGAGCAAGAAAGCGCTGAACTTGAAGCCGGAGAAGTCATGGAAGAACAACCAACGACTGAGGACCAATCTGACTATGCCTCTTGGCCTCCGGCGATGCGCTTCGATGTTCCTCCTTACAAAACCTACCATTTTTCCAGACATTTTAGAGCCTCGTCTAACCCTAATAACTTCCTCAAGGGCGTTAAATGGTCTCCGGATGGTTCCTGCTTTCTCACGAGCTCTGATGACAATACTCTTAGTTTATTCAC...
1272 bp · LXL04_027190|LXL04_027190|OH1004|CDS
ATGGGGCAGCAGGAGCAAGAAAGCGCTGAACTTGAAGCCGGAGAAGTCATGGAAGAACAACCAACGACTGAGGACCAATCTGACTATGCCTCTTGGCCTCCGGCGATGCGCTTCGATGTTCCTCCTTACAAAACCTACCATTTTTCCAGACATTTTAGAGCCTCGTCTAACCCTAATAACTTCCTCAAGGGCGTTAAATGGTCTCCGGATGGTTCCTGCTTTCTCACGAGCTCTGATGACAATACTCTTAGTTTATTCAC...
Protein
Download Protein FASTA423 aa · LXL04_027190|LXL04_027190|OH1004|PROTEIN
MGQQEQESAELEAGEVMEEQPTTEDQSDYASWPPAMRFDVPPYKTYHFSRHFRASSNPNNFLKGVKWSPDGSCFLTSSDDNTLSLFTLPDHENATDEKNCSSSATEDSFPASLALTEGEAIYDYCWYPYMSSSDPVSCVFATTTRDHPIHLWDTTTGQLRCTYRAYDNMDEITAAFSIGFNPTGTKIFAGYNKSIRIFDIHRPGRDFQQHSTIQGNKEGQSGIISSIAFSPSHTGMLATGSYSQTTAIHREDNMELLYVL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_027190 |
|---|---|
| TK1151 ID | TkA07G039510 |
| OH-1004 ID | LXL04_027190 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.800 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_027190 |
|---|---|
| Location | Chr06:10737526-10740119 (-) |
| Description | Similar to Wrap53: Telomerase Cajal body protein 1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006281 DNA repair Biological Process GO:0007004 telomere maintenance via telomerase Biological Process GO:0030576 Cajal body organization Biological Process GO:0032203 telomere formation via telomerase Biological Process GO:0032212 positive regulation of telomere maintenance via telomerase Biological Process GO:0034337 RNA folding Biological Process GO:0045739 positive regulation of DNA repair Biological Process GO:0090666 scaRNA localization to Cajal body Biological Process GO:0090671 telomerase RNA localization to Cajal body Biological Process GO:1904851 positive regulation of establishment of protein localization to telomere Biological Process GO:1904867 protein localization to Cajal body Biological Process GO:1905168 positive regulation of double-strand break repair via homologous recombination Biological Process |
| KEGG gene cross-reference | bta:509631 hsa:55135 maua:101834343 mmu:216853 rno:287432 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF25174.2Beta-prop_THOC363-368 aaPF23414.2Beta-prop_EML_2135-299 aaPF24805.2EIF3I136-295 aaPF23409.2Beta-prop_EML142-295 aaPF25391.2WD40_Gbeta142-297 aaPF24817.2WD40_WDHD1_1st144-301 aaPF24807.2WD40_CDC20-Fz148-298 aaPF23381.2Beta-prop_IFT122_1st177-282 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_027190 | PF25174.2 | Beta-prop_THOC3 | 63 | 368 | 1.1e-26 | 94.2 |
| LXL04_027190 | PF23414.2 | Beta-prop_EML_2 | 135 | 299 | 4.3e-19 | 69.6 |
| LXL04_027190 | PF24805.2 | EIF3I | 136 | 295 | 2.7e-09 | 37.3 |
| LXL04_027190 | PF23409.2 | Beta-prop_EML | 142 | 295 | 1.5e-09 | 38.5 |
| LXL04_027190 | PF25391.2 | WD40_Gbeta | 142 | 297 | 2.3e-08 | 34.1 |
| LXL04_027190 | PF24817.2 | WD40_WDHD1_1st | 144 | 301 | 3.6e-14 | 53.4 |
| LXL04_027190 | PF24807.2 | WD40_CDC20-Fz | 148 | 298 | 2.9e-21 | 76.8 |
| LXL04_027190 | PF23381.2 | Beta-prop_IFT122_1st | 177 | 282 | 6.2e-22 | 78.9 |
| LXL04_027190 | PF24814.2 | WD40_Prp19 | 209 | 363 | 4.4e-21 | 75.9 |
| LXL04_027190 | PF25047.1 | Beta-prop_TEP1_2nd | 216 | 358 | 1.6e-10 | 41.4 |
| LXL04_027190 | PF25173.2 | Beta-prop_WDR3_1st | 218 | 370 | 1.6e-20 | 74.3 |
| LXL04_027190 | PF25175.2 | Beta-prop_WDR5 | 219 | 404 | 6.2e-28 | 98.6 |
| LXL04_027190 | PF24807.2 | WD40_CDC20-Fz | 220 | 367 | 2.9e-21 | 76.8 |
| LXL04_027190 | PF24796.2 | WDR55 | 223 | 371 | 1e-11 | 45.2 |
| LXL04_027190 | PF23381.2 | Beta-prop_IFT122_1st | 224 | 304 | 6.2e-22 | 78.9 |
| LXL04_027190 | PF00400.39 | WD40 | 255 | 293 | 1.3e-22 | 80.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.