LXL04_027185 | RubberDandelionOmics

Gene overview

LXL04_027185

Reference: OH-1004 Chr: Chr06 Coordinates: 10596980-10599821 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1566 bp · LXL04_027185|LXL04_027185|OH1004|cDNA

ATGGCCGGCGGTGGAATTCCGACCGCTCCCGGCGGTGATAAAGCTTATCCCGGGAACCTCACTCTCTATGTTACCTTTACCTGCGTTGTTGCAGCCATGGGTGGTCTCATTTTCGGTTATGATATCGGAATCTCTGGTGGTGTGACGGCGATGGATCCATTTCTAATGAAGTTCTTCCCGTCGGTGTACCGGAAACAATCGGCTGATACCTCGACAAATCAATACTGCAAGTTTGACAGTCAGACGTTGACTATGTTTAC...

CDS

Download CDS FASTA

1566 bp · LXL04_027185|LXL04_027185|OH1004|CDS

ATGGCCGGCGGTGGAATTCCGACCGCTCCCGGCGGTGATAAAGCTTATCCCGGGAACCTCACTCTCTATGTTACCTTTACCTGCGTTGTTGCAGCCATGGGTGGTCTCATTTTCGGTTATGATATCGGAATCTCTGGTGGTGTGACGGCGATGGATCCATTTCTAATGAAGTTCTTCCCGTCGGTGTACCGGAAACAATCGGCTGATACCTCGACAAATCAATACTGCAAGTTTGACAGTCAGACGTTGACTATGTTTAC...

Protein

Download Protein FASTA

521 aa · LXL04_027185|LXL04_027185|OH1004|PROTEIN

MAGGGIPTAPGGDKAYPGNLTLYVTFTCVVAAMGGLIFGYDIGISGGVTAMDPFLMKFFPSVYRKQSADTSTNQYCKFDSQTLTMFTSSLYLAALLSSLVASTVTRKLGRKLSMLFGGILFCAGALINGFAQAVWMLIVGRILLGFGIGFANQSVPLYLSEMAPYKYRGSLNIGFQLSITIGILVANILNYFFNKLDGNLGWRLSLGGAVVPALIITVGSLILPETPNSMIERGQKEEARTKLRRIRGVDDIDEEFNDLV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027185`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027185

Location Chr06:10596980-10599821 (-)

Description Similar to STC: Sugar carrier protein C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11260`	Major hexose transporter.	Monosaccharide/proton symporter AtSTP1 plays a major role in uptake and response of Arabidopsis seeds and seedlings to sugars.2000 · DOI: 10.1046/j.1365-313x.2000.00935.x Functional expression of a plant plasma membrane transporter in Xenopus oocytes.1992 · DOI: 10.1016/0014-5793(92)80431-f Primary structure, genomic organization and heterologous expression of a glucose transporter from Arabidopsis thaliana.1990 · DOI: 10.1002/j.1460-2075.1990.tb07500.x Functional reconstitution of the solubilized Arabidopsis thaliana STP1 monosaccharide-H+ symporter in lipid vesicles and purification of the histidine tagged protein from transgenic Saccharomyces cerevisiae.1994 · DOI: 10.1046/j.1365-313x.1994.6020225.x Steady-state and presteady-state kinetics of the H+/hexose cotransporter (STP1) from Arabidopsis thaliana expressed in Xenopus oocytes.1994 · DOI: 10.1016/s0021-9258(17)32008-2
`At4g21480`	Mediates an active uptake of hexoses, probably by sugar/hydrogen symport.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0106200`	Mediates active uptake of hexoses by sugar:proton symport.	Characterization and expression of monosaccharide transporters (osMSTs) in rice.2000 · DOI: 10.1093/pcp/pcd016
`Os07g0559700`	Mediates active uptake of hexoses by sugar:proton symport (Probable).	Molecular cloning, functional characterization and expression analysis of a novel monosaccharide transporter gene OsMST6 from rice (Oryza sativa L.).2008 · DOI: 10.1007/s00425-008-0755-8

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027185 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009624 response to nematode Biological Process

GO:0015749 monosaccharide transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

GO:0015145 monosaccharide transmembrane transporter activity Molecular Function

GO:0015293 symporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G11260

ath:AT4G21480

dosa:Os07g0106200

dosa:Os07g0559700

osa:4343590

rcu:8275367

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.856

Rank 1 · LXL04_027185 · OH-1004

Cytoplasm0.116

Rank 2 · LXL04_027185 · OH-1004

Endoplasmic reticulum0.037

Rank 3 · LXL04_027185 · OH-1004

Mitochondrion0.035

Rank 4 · LXL04_027185 · OH-1004

Lysosome / Vacuole0.030

Rank 5 · LXL04_027185 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00083.31Sugar_tr28-490 aa

PF07690.22MFS_178-440 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027185	`PF00083.31`	Sugar_tr	28	490	1.5e-136	456.6
LXL04_027185	`PF07690.22`	MFS_1	78	440	2.7e-27	96.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P23586`	Arabidopsis thaliana	Sugar transport protein 1	81.818%	Swiss-Prot	strong database homology
`O65413`	Arabidopsis thaliana	Sugar transport protein 12	80.527%	Swiss-Prot	strong database homology
`Q7EZD7`	Oryza sativa subsp. japonica	Sugar transport protein MST3	69.863%	Swiss-Prot	strong database homology
`Q6Z401`	Oryza sativa subsp. japonica	Sugar transport protein MST6	69.531%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card