LXL04_027098 | RubberDandelionOmics

Gene overview

LXL04_027098

Reference: OH-1004 Chr: Chr06 Coordinates: 8932216-8933451 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1236 bp · LXL04_027098|LXL04_027098|OH1004|cDNA

ATGGCTTCCAACATCATCTTTCGACGATTCAATTCCTTTCGTCATCTTCAAGCTCGGTTTTTCTCCTCAGTTCTAAACCCTGATTTCACAACTCCTCTCTCCAGCAAAGAGAAATCTCGCACCGCTCTTTCTCTCCTCAAAAGGGAGAAGAACCCGGAACGCATCATCGACATCTGCCGAGCAGCTTCACTCACACCGGAGTCACATCTAGATCGCATAGCATTCTCAATCGCGATATCCAAGCTCGCGGATTTGAATTA...

CDS

Download CDS FASTA

1236 bp · LXL04_027098|LXL04_027098|OH1004|CDS

ATGGCTTCCAACATCATCTTTCGACGATTCAATTCCTTTCGTCATCTTCAAGCTCGGTTTTTCTCCTCAGTTCTAAACCCTGATTTCACAACTCCTCTCTCCAGCAAAGAGAAATCTCGCACCGCTCTTTCTCTCCTCAAAAGGGAGAAGAACCCGGAACGCATCATCGACATCTGCCGAGCAGCTTCACTCACACCGGAGTCACATCTAGATCGCATAGCATTCTCAATCGCGATATCCAAGCTCGCGGATTTGAATTA...

Protein

Download Protein FASTA

411 aa · LXL04_027098|LXL04_027098|OH1004|PROTEIN

MASNIIFRRFNSFRHLQARFFSSVLNPDFTTPLSSKEKSRTALSLLKREKNPERIIDICRAASLTPESHLDRIAFSIAISKLADLNYLDGIRDFIEELLKTRPDLNNEKFISHAIIYYGQAGLLDNAFQLFDQMSQLGVPQNAKSLNALLFSCMVAKQYNEVKRVYLEFPLKYDVTPNLDTYNTVIKSFCESGSSTSCYPVISEMVNRNCKPNATTFGTLIAGFYKEEKLEEVGNVLNLMRKYEVPIGISTYNTRIQSLC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027098`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027098

Location Chr06:8932216-8933451 (+)

Description Similar to PPR336: Pentatricopeptide repeat-containing protein At1g61870, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g61870`	May be involved in translation through its association with polysomes.	No verified direct reference in this release
`At1g11630`	Pentatricopeptide repeat-containing protein At1g11630, mitochondrial.	No verified direct reference in this release
`At4g36680`	Small ribosomal subunit protein mL103 (rPPR7).	No verified direct reference in this release
`At2g18520`	Pentatricopeptide repeat-containing protein At2g18520, mitochondrial.	No verified direct reference in this release
`At1g55890`	Small ribosomal subunit protein mS78 (rPPR3a).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027098 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006396 RNA processing Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005840 ribosome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0000166 nucleotide binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G11630

ath:AT1G55890

ath:AT1G61870

ath:AT2G18520

ath:AT4G36680

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.853

Rank 1 · LXL04_027098 · OH-1004

Plastid0.088

Rank 2 · LXL04_027098 · OH-1004

Nucleus0.050

Rank 3 · LXL04_027098 · OH-1004

Cytoplasm0.037

Rank 4 · LXL04_027098 · OH-1004

Cell membrane0.012

Rank 5 · LXL04_027098 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29070.1MSC6_N79-193 aa

PF17177.11PPR_long124-213 aa

PF13812.13PPR_3130-189 aa

PF12854.14PPR_1175-193 aa

PF13041.13PPR_2177-226 aa

PF29070.1MSC6_N202-339 aa

PF13041.13PPR_2216-261 aa

PF13041.13PPR_2249-287 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027098	`PF29070.1`	MSC6_N	79	193	2.5e-17	63.8
LXL04_027098	`PF17177.11`	PPR_long	124	213	7e-12	45.9
LXL04_027098	`PF13812.13`	PPR_3	130	189	2.3e-20	73.1
LXL04_027098	`PF12854.14`	PPR_1	175	193	3.8e-42	142.4
LXL04_027098	`PF13041.13`	PPR_2	177	226	1.8e-42	144.0
LXL04_027098	`PF29070.1`	MSC6_N	202	339	2.5e-17	63.8
LXL04_027098	`PF13041.13`	PPR_2	216	261	1.8e-42	144.0
LXL04_027098	`PF13041.13`	PPR_2	249	287	1.8e-42	144.0
LXL04_027098	`PF13812.13`	PPR_3	277	323	2.3e-20	73.1
LXL04_027098	`PF12854.14`	PPR_1	279	310	3.8e-42	142.4
LXL04_027098	`PF13041.13`	PPR_2	282	331	1.8e-42	144.0
LXL04_027098	`PF01535.27`	PPR	285	315	1.1e-33	113.8
LXL04_027098	`PF12854.14`	PPR_1	314	343	3.8e-42	142.4
LXL04_027098	`PF13041.13`	PPR_2	317	366	1.8e-42	144.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LE47`	Arabidopsis thaliana	Small ribosomal subunit protein mS86 (rPPR1)	53.944%	Swiss-Prot	strong database homology
`Q9SAB4`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g11630, mitochondrial	49.863%	Swiss-Prot	moderate database homology
`Q9M065`	Arabidopsis thaliana	Small ribosomal subunit protein mL103 (rPPR7)	31.008%	Swiss-Prot	moderate database homology
`Q9ZU67`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g18520, mitochondrial	29.353%	Swiss-Prot	weak database homology
`Q9LG23`	Arabidopsis thaliana	Small ribosomal subunit protein mS78 (rPPR3a)	29.598%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card