LXL04_027071 | RubberDandelionOmics

Gene overview

LXL04_027071

Reference: OH-1004 Chr: Chr06 Coordinates: 8173864-8174811 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

417 bp · LXL04_027071|LXL04_027071|OH1004|cDNA

ATGTTTTTCAATTGTTTGAAATCTGCAGAAAGAAATCAGAGTGCAGACATGGCTAAATGCTCCTTCAAGCTCGAACACACCTTGGAGAAGAGGAAAAGTGAATCATCTCGCATCAGAGAGAAGTATCCCGATAGAGTACCAGTGATTGTTGAAAAAGCTGAAAAATCCGACATTCCTGACATAGACAAAAAGAAGTATCTAGTGCCAGCTGATTTGACAATTGGTCAATTTGTGTATGTGGTTCGAAAGAGGATTAAACT...

CDS

Download CDS FASTA

417 bp · LXL04_027071|LXL04_027071|OH1004|CDS

ATGTTTTTCAATTGTTTGAAATCTGCAGAAAGAAATCAGAGTGCAGACATGGCTAAATGCTCCTTCAAGCTCGAACACACCTTGGAGAAGAGGAAAAGTGAATCATCTCGCATCAGAGAGAAGTATCCCGATAGAGTACCAGTGATTGTTGAAAAAGCTGAAAAATCCGACATTCCTGACATAGACAAAAAGAAGTATCTAGTGCCAGCTGATTTGACAATTGGTCAATTTGTGTATGTGGTTCGAAAGAGGATTAAACT...

Protein

Download Protein FASTA

138 aa · LXL04_027071|LXL04_027071|OH1004|PROTEIN

MFFNCLKSAERNQSADMAKCSFKLEHTLEKRKSESSRIREKYPDRVPVIVEKAEKSDIPDIDKKKYLVPADLTIGQFVYVVRKRIKLSSEKAIFVFVKNMLPPTAALMSAVYEENKDEDGFLYMNYSGENTFGSFEME

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027071`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027071

Location Chr06:8173864-8174811 (-)

Description Similar to ATG8CL: Autophagy-related protein 8C-like

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0191600`	Ubiquitin-like modifier involved in autophagosomes formation.	No verified direct reference in this release
`UniProt: A2YS06`	Ubiquitin-like modifier involved in autophagosomes formation.	No verified direct reference in this release
`Os04g0624000`	Ubiquitin-like modifier involved in autophagosomes formation.	No verified direct reference in this release
`UniProt: A2XXR7`	Ubiquitin-like modifier involved in autophagosomes formation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027071 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000045 autophagosome assembly Biological Process

GO:0000423 mitophagy Biological Process

GO:0006914 autophagy Biological Process

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0015031 protein transport Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0097352 autophagosome maturation Biological Process

GO:0000421 autophagosome membrane Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0031410 cytoplasmic vesicle Cellular Component

KEGG gene cross-reference

dosa:Os04g0624000

dosa:Os08g0191600

osa:4337052

sot:102578628

sot:102593150

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.621

Rank 1 · LXL04_027071 · OH-1004

Nucleus0.207

Rank 2 · LXL04_027071 · OH-1004

Lysosome / Vacuole0.192

Rank 3 · LXL04_027071 · OH-1004

Golgi apparatus0.128

Rank 4 · LXL04_027071 · OH-1004

Cell membrane0.097

Rank 5 · LXL04_027071 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02991.23ATG830-133 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027071	`PF02991.23`	ATG8	30	133	1.1e-50	170.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6Z1D5`	Oryza sativa subsp. japonica	Autophagy-related protein 8C	85.714%	Swiss-Prot	strong database homology
`A2YS06`	Oryza sativa subsp. indica	Autophagy-related protein 8C	85.714%	Swiss-Prot	strong database homology
`Q7XPR1`	Oryza sativa subsp. japonica	Autophagy-related protein 8B	86.325%	Swiss-Prot	strong database homology
`A2XXR7`	Oryza sativa subsp. indica	Autophagy-related protein 8B	86.325%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card