LXL04_027065 | RubberDandelionOmics

Gene overview

LXL04_027065

Reference: OH-1004 Chr: Chr06 Coordinates: 8141883-8144458 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1734 bp · LXL04_027065|LXL04_027065|OH1004|cDNA

ATGAAACTACCATTGTATCCTATGGGTGTAAGCTATCTCTCAATATCAGCAGCCTGTACAGTATTGAGCTTTATAGCCCTCCAATACTGTACAGATATTTCCTATGTAAAAATAATGCAAGATGGTTTCATGGGTGAAAATCTTCTCGACCCTGGTGTTGCCAACCGTGTACTCCATCTGTTGATCAGTTCCTACACCACAATTGCATTTGTTGCCAGTTTTGCCCTCAACATTTTTATGCTCATCCTCCTCTCTCTCAA...

CDS

Download CDS FASTA

1734 bp · LXL04_027065|LXL04_027065|OH1004|CDS

ATGAAACTACCATTGTATCCTATGGGTGTAAGCTATCTCTCAATATCAGCAGCCTGTACAGTATTGAGCTTTATAGCCCTCCAATACTGTACAGATATTTCCTATGTAAAAATAATGCAAGATGGTTTCATGGGTGAAAATCTTCTCGACCCTGGTGTTGCCAACCGTGTACTCCATCTGTTGATCAGTTCCTACACCACAATTGCATTTGTTGCCAGTTTTGCCCTCAACATTTTTATGCTCATCCTCCTCTCTCTCAA...

Protein

Download Protein FASTA

577 aa · LXL04_027065|LXL04_027065|OH1004|PROTEIN

MKLPLYPMGVSYLSISAACTVLSFIALQYCTDISYVKIMQDGFMGENLLDPGVANRVLHLLISSYTTIAFVASFALNIFMLILLSLKTIFFVEIHSTESHKLVERLVNYVIYKGTFLPLVVPPTLVRAGLWSTWLTVLCSLKMFQALARDRLERLNASPSATPWAYFRVYSALLLVFIVDAVWIRVCVAIYQTLPSSMFLLLFFEPLSIAFETLQAILVHGFQLVDIWVHNSVGNTTNSKISKLLDMSAAGSLWEWKSVI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027065`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027065

Location Chr06:8141883-8144458 (+)

Description Similar to RIN2: E3 ubiquitin protein ligase RIN2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g25230`	E3 ubiquitin protein ligase that acts as a positive regulator of RPM1- and RPS2-dependent hypersensitive response (HR), in association with RIN3.	A duplicated pair of Arabidopsis RING-finger E3 ligases contribute to the RPM1- and RPS2-mediated hypersensitive response.2005 · DOI: 10.1111/j.1365-313x.2005.02525.x
`At5g51450`	E3 ubiquitin protein ligase that acts as a positive regulator of RPM1- and RPS2-dependent hypersensitive response (HR), in association with RIN2.	A duplicated pair of Arabidopsis RING-finger E3 ligases contribute to the RPM1- and RPS2-mediated hypersensitive response.2005 · DOI: 10.1111/j.1365-313x.2005.02525.x
`At3g16090`	Probable component of the HRD1 ubiquitin ligase complex that mediates the rapid degradation of misfolded endoplasmic reticulum (ER) proteins, a process called ER-associated degradation (ERAD).	No verified direct reference in this release
`At1g65040`	Probable component of the HRD1 ubiquitin ligase complex that mediates the rapid degradation of misfolded endoplasmic reticulum (ER) proteins, a process called ER-associated degradation (ERAD).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0301000`	Probable component of the HRD1 ubiquitin ligase complex that mediates the rapid degradation of misfolded endoplasmic reticulum (ER) proteins, a process called ER-associated degradation (ERAD).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027065 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0034052 positive regulation of plant-type hypersensitive response Biological Process

GO:0036503 ERAD pathway Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:1904276 regulation of wax biosynthetic process Biological Process

GO:0000151 ubiquitin ligase complex Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G65040

ath:AT3G16090

ath:AT4G25230

ath:AT5G51450

dosa:Os06g0301000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.526

Rank 1 · LXL04_027065 · OH-1004

Golgi apparatus0.273

Rank 2 · LXL04_027065 · OH-1004

Nucleus0.147

Rank 3 · LXL04_027065 · OH-1004

Cytoplasm0.115

Rank 4 · LXL04_027065 · OH-1004

Cell membrane0.069

Rank 5 · LXL04_027065 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25563.1TPR_SYVN1_N61-310 aa

PF12678.14zf-rbx1340-387 aa

PF13639.13zf-RING_2343-387 aa

PF00097.32zf-C3HC4345-386 aa

PF13445.13zf-RING_UBOX345-384 aa

PF02845.23CUE541-577 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027065	`PF25563.1`	TPR_SYVN1_N	61	310	4.5e-17	63.1
LXL04_027065	`PF12678.14`	zf-rbx1	340	387	1.1e-07	32.7
LXL04_027065	`PF13639.13`	zf-RING_2	343	387	3.1e-09	37.7
LXL04_027065	`PF00097.32`	zf-C3HC4	345	386	1.5e-07	31.9
LXL04_027065	`PF13445.13`	zf-RING_UBOX	345	384	1.1e-06	29.3
LXL04_027065	`PF02845.23`	CUE	541	577	9.2e-10	38.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYC8`	Arabidopsis thaliana	E3 ubiquitin protein ligase RIN2	56.973%	Swiss-Prot	strong database homology
`Q8W4Q5`	Arabidopsis thaliana	E3 ubiquitin protein ligase RIN3	56.706%	Swiss-Prot	strong database homology
`Q9LW77`	Arabidopsis thaliana	ERAD-associated E3 ubiquitin-protein ligase HRD1A	27.247%	Swiss-Prot	weak database homology
`Q6NPT7`	Arabidopsis thaliana	ERAD-associated E3 ubiquitin-protein ligase HRD1B	25.989%	Swiss-Prot	weak database homology
`Q5Z880`	Oryza sativa subsp. japonica	ERAD-associated E3 ubiquitin-protein ligase HRD1	25.552%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card