LXL04_027049 | RubberDandelionOmics

Gene overview

LXL04_027049

Reference: OH-1004 Chr: Chr06 Coordinates: 7812960-7815269 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1605 bp · LXL04_027049|LXL04_027049|OH1004|cDNA

ATGGTGAATTTTACTTTGGGCCCAACTTTGGATACTTCGGAGCCTTTGGTGTTATTGAACAAGAATACCCGGTGGAACCCGTTCTCGATGGTTCCAGGCGGCGCCGCTGATCATGCGGTGGCTGATCAAGGTGAAGATTCTCATCGGAAAGTTTTGGCTGAGATGGATCTTTTTTCCACAAGAAATCATACTGCAACTTATAATAGGGTTGATGTGAAGAAGGAGAATTTTCTTGGGAACGATCTTAATCTAAATACTGG...

CDS

Download CDS FASTA

1605 bp · LXL04_027049|LXL04_027049|OH1004|CDS

ATGGTGAATTTTACTTTGGGCCCAACTTTGGATACTTCGGAGCCTTTGGTGTTATTGAACAAGAATACCCGGTGGAACCCGTTCTCGATGGTTCCAGGCGGCGCCGCTGATCATGCGGTGGCTGATCAAGGTGAAGATTCTCATCGGAAAGTTTTGGCTGAGATGGATCTTTTTTCCACAAGAAATCATACTGCAACTTATAATAGGGTTGATGTGAAGAAGGAGAATTTTCTTGGGAACGATCTTAATCTAAATACTGG...

Protein

Download Protein FASTA

534 aa · LXL04_027049|LXL04_027049|OH1004|PROTEIN

MVNFTLGPTLDTSEPLVLLNKNTRWNPFSMVPGGAADHAVADQGEDSHRKVLAEMDLFSTRNHTATYNRVDVKKENFLGNDLNLNTGLNLVTKANNGDEDRSRNTIDKLNEIRDELERMNMENQRLREMCLQVSNNYNALQMHYVNVMHQQEQELSIQKQEENVDHPSRDQVSVAIPRQFMELGQNTHDSSSEEKTLSGSALNTIELSKNVNKDSKTIGREATPDSDVWTSKKVPKLDVPENIVDQTNDTTMRKVRVSVR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027049`
TK1151 ID	TkA07G028220
OH-1004 ID	LXL04_027049
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027049

Location Chr06:7812960-7815269 (+)

Description Similar to WRKY42: WRKY transcription factor 42

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g04450`	Transcription factor.	WRKY42 modulates phosphate homeostasis through regulating phosphate translocation and acquisition in Arabidopsis.2015 · DOI: 10.1104/pp.114.253799
`At1g62300`	Transcription factor involved in the control of processes related to senescence and pathogen defense.	Targets of AtWRKY6 regulation during plant senescence and pathogen defense.2002 · DOI: 10.1101/gad.222702 WRKY42 modulates phosphate homeostasis through regulating phosphate translocation and acquisition in Arabidopsis.2015 · DOI: 10.1104/pp.114.253799
`At4g22070`	Transcription factor.	No verified direct reference in this release
`At4g01720`	Transcription factor.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027049 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0080169 cellular response to boron-containing substance deprivation Biological Process

GO:1900057 positive regulation of leaf senescence Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G62300

ath:AT4G01720

ath:AT4G04450

ath:AT4G22070

sly:100529138

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.967

Rank 1 · LXL04_027049 · OH-1004

Cytoplasm0.096

Rank 2 · LXL04_027049 · OH-1004

Cell membrane0.021

Rank 3 · LXL04_027049 · OH-1004

Endoplasmic reticulum0.010

Rank 4 · LXL04_027049 · OH-1004

Plastid0.009

Rank 5 · LXL04_027049 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03106.22WRKY289-346 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027049	`PF03106.22`	WRKY	289	346	1.3e-25	90.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XEC3`	Arabidopsis thaliana	WRKY transcription factor 42	42.676%	Swiss-Prot	moderate database homology
`Q9C519`	Arabidopsis thaliana	WRKY transcription factor 6	45.251%	Swiss-Prot	moderate database homology
`Q93WT0`	Arabidopsis thaliana	Probable WRKY transcription factor 31	45.811%	Swiss-Prot	moderate database homology
`Q9ZSI7`	Arabidopsis thaliana	Probable WRKY transcription factor 47	39.431%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card