LXL04_026953 | RubberDandelionOmics

Gene overview

LXL04_026953

Reference: OH-1004 Chr: Chr06 Coordinates: 5841256-5843209 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1434 bp · LXL04_026953|LXL04_026953|OH1004|cDNA

ATGGCTGAAAGAAAAGCTGAAAATTTTCGTCAATGGCAGAAACATAACAGAGGCATGGATAATTCGAAGCAAATAAACTCTTCTGATGATATGATCAGTCAATTACCGGATCCAATTCTTCACTCAATTCTTTCACGTATTCCAGCAACCGAAGAAGTAATCCGAACCAGCATTTTATCAACACGATGGAGATATTTATGGACTTCACTTTCCTCCATAGACATAGATATTACCCGAAGACTAAACCCCCATGAAAGATT...

CDS

Download CDS FASTA

1434 bp · LXL04_026953|LXL04_026953|OH1004|CDS

ATGGCTGAAAGAAAAGCTGAAAATTTTCGTCAATGGCAGAAACATAACAGAGGCATGGATAATTCGAAGCAAATAAACTCTTCTGATGATATGATCAGTCAATTACCGGATCCAATTCTTCACTCAATTCTTTCACGTATTCCAGCAACCGAAGAAGTAATCCGAACCAGCATTTTATCAACACGATGGAGATATTTATGGACTTCACTTTCCTCCATAGACATAGATATTACCCGAAGACTAAACCCCCATGAAAGATT...

Protein

Download Protein FASTA

477 aa · LXL04_026953|LXL04_026953|OH1004|PROTEIN

MAERKAENFRQWQKHNRGMDNSKQINSSDDMISQLPDPILHSILSRIPATEEVIRTSILSTRWRYLWTSLSSIDIDITRRLNPHERFKNNKFDKFMFHILENTHPDLNSFRLHCGNYFTMLPVSRWIQAATMRKVKSLDLKFCLKNESINVPNCVVTCGSLEELRLHLFGCCLRLPDCNGFSVIRVLELDNVRLSNCGIVTDFLKNCPLLEELSLKNLEVSQSRFGVDRMFRMGENVNRDIRISQSPFGGYGMFSIGEIN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026953`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026953

Location Chr06:5841256-5843209 (+)

Description Similar to At1g51370: F-box/FBD/LRR-repeat protein At1g51370

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g51370`	F-box/FBD/LRR-repeat protein At1g51370.	No verified direct reference in this release
`At1g78760`	Putative F-box/FBD/LRR-repeat protein At1g78760.	No verified direct reference in this release
`At3g58860`	Putative F-box protein At3g58860.	No verified direct reference in this release
`At3g52680`	F-box/FBD/LRR-repeat protein At3g52680.	No verified direct reference in this release
`At5g22730`	FBD-associated F-box protein At5g22730.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026953 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G51370

ath:AT1G78760

ath:AT3G52680

ath:AT3G58860

ath:AT5G22730

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.873

Rank 1 · LXL04_026953 · OH-1004

Cytoplasm0.193

Rank 2 · LXL04_026953 · OH-1004

Cell membrane0.038

Rank 3 · LXL04_026953 · OH-1004

Endoplasmic reticulum0.028

Rank 4 · LXL04_026953 · OH-1004

Plastid0.013

Rank 5 · LXL04_026953 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646.39F-box32-71 aa

PF23622.2LRR_At1g61320_AtMIF1116-217 aa

PF24758.2LRR_At5g56370124-219 aa

PF23622.2LRR_At1g61320_AtMIF1258-457 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026953	`PF00646.39`	F-box	32	71	6.6e-07	29.7
LXL04_026953	`PF23622.2`	LRR_At1g61320_AtMIF1	116	217	1.2e-09	38.8
LXL04_026953	`PF24758.2`	LRR_At5g56370	124	219	6.5e-10	39.8
LXL04_026953	`PF23622.2`	LRR_At1g61320_AtMIF1	258	457	1.2e-09	38.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6DBN6`	Arabidopsis thaliana	F-box/FBD/LRR-repeat protein At1g51370	30.928%	Swiss-Prot	weak database homology
`Q9ZV94`	Arabidopsis thaliana	Putative F-box/FBD/LRR-repeat protein At1g78760	27.979%	Swiss-Prot	weak database homology
`Q9LXR6`	Arabidopsis thaliana	Putative F-box protein At3g58860	28.846%	Swiss-Prot	weak database homology
`Q9LXJ6`	Arabidopsis thaliana	F-box/FBD/LRR-repeat protein At3g52680	28.612%	Swiss-Prot	weak database homology
`Q9FNI8`	Arabidopsis thaliana	FBD-associated F-box protein At5g22730	24.286%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card