LXL04_026884 | RubberDandelionOmics

Gene overview

LXL04_026884

Reference: OH-1004 Chr: Chr06 Coordinates: 4620132-4625286 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1299 bp · LXL04_026884|LXL04_026884|OH1004|cDNA

ATGAATCAGTGTGTACCAAGTTGGGATCTTGAAGACATCAACCCTAATCAGAATGTTTTCAAATTGGATTTTGAAGTGGCCGAATTAACATGGGAAAACGGGCAGTTGGCCATGCACGAGTTGGGTCACCGGCGCGTGCCTTCCAAATACACATGGAGCAAGCCACGCGCCGCCGAGACTCTAGAGGCGATAGTCGACCAAGCCAAGCTCCAAACCTACAACAAAGTAGCGGTTAACGGCGAAGAAGTTGTACCATGGCT...

CDS

Download CDS FASTA

1299 bp · LXL04_026884|LXL04_026884|OH1004|CDS

ATGAATCAGTGTGTACCAAGTTGGGATCTTGAAGACATCAACCCTAATCAGAATGTTTTCAAATTGGATTTTGAAGTGGCCGAATTAACATGGGAAAACGGGCAGTTGGCCATGCACGAGTTGGGTCACCGGCGCGTGCCTTCCAAATACACATGGAGCAAGCCACGCGCCGCCGAGACTCTAGAGGCGATAGTCGACCAAGCCAAGCTCCAAACCTACAACAAAGTAGCGGTTAACGGCGAAGAAGTTGTACCATGGCT...

Protein

Download Protein FASTA

432 aa · LXL04_026884|LXL04_026884|OH1004|PROTEIN

MNQCVPSWDLEDINPNQNVFKLDFEVAELTWENGQLAMHELGHRRVPSKYTWSKPRAAETLEAIVDQAKLQTYNKVAVNGEEVVPWLQHRRNPTAATGSVNASGTMTSDALVPSSNNRASALDGGCSTRVGSCSADQSAFLGRRRDGQGGGSTTVAGHEWSSCRDRSVSTWSETVATIDTYDGDGDGDLGGSRLMSTSTGSPQNTSSGEDCSKSTSPDDSACHCRPQPDANVAREKRKGKAKPSISNKRRRTAAIHNQSE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026884`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026884

Location Chr06:4620132-4625286 (-)

Description Similar to UNE10: Transcription factor UNE10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g00050`	Transcription factor binding to G-box elements (5'-CACGTG-3') in target genes promoters, particularly in far-red light but barely in the dark.	PHYTOCHROME INTERACTING FACTOR8 Inhibits Phytochrome A-Mediated Far-Red Light Responses in Arabidopsis.2020 · DOI: 10.1105/tpc.19.00515
`At1g09530`	Transcription factor acting in the phytochrome signaling pathway.	PHYTOCHROME INTERACTING FACTOR3 associates with the histone deacetylase HDA15 in repression of chlorophyll biosynthesis and photosynthesis in etiolated Arabidopsis seedlings.2013 · DOI: 10.1105/tpc.113.109710 Coordinated Regulation of Hypocotyl Cell Elongation by Light and Ethylene through a Microtubule Destabilizing Protein.2018 · DOI: 10.1104/pp.17.01109 Submergence stress-induced hypocotyl elongation through ethylene signaling-mediated regulation of cortical microtubules in Arabidopsis.2020 · DOI: 10.1093/jxb/erz453 PHYTOCHROME INTERACTING FACTOR8 Inhibits Phytochrome A-Mediated Far-Red Light Responses in Arabidopsis.2020 · DOI: 10.1105/tpc.19.00515
`At5g67110`	Required for the dehiscence of fruit, especially for the separation of the valve cells from the replum.	No verified direct reference in this release
`At2g20180`	Transcription activator.	SOMNUS, a CCCH-type zinc finger protein in Arabidopsis, negatively regulates light-dependent seed germination downstream of PIL5.2008 · DOI: 10.1105/tpc.108.058859

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0286100`	Transcription factor that may act as negative regulator of phyB-dependent light signal transduction.	Characterization of a set of phytochrome-interacting factor-like bHLH proteins in Oryza sativa.2007 · DOI: 10.1271/bbb.60643

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026884 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006783 heme biosynthetic process Biological Process

GO:0007165 signal transduction Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009567 double fertilization forming a zygote and endosperm Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0009637 response to blue light Biological Process

GO:0009639 response to red or far red light Biological Process

GO:0009686 gibberellin biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT1G09530

ath:AT2G20180

ath:AT4G00050

ath:AT5G67110

dosa:Os01g0286100

osa:4327916

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.979

Rank 1 · LXL04_026884 · OH-1004

Cytoplasm0.086

Rank 2 · LXL04_026884 · OH-1004

Cell membrane0.022

Rank 3 · LXL04_026884 · OH-1004

Endoplasmic reticulum0.012

Rank 4 · LXL04_026884 · OH-1004

Plastid0.009

Rank 5 · LXL04_026884 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010.32HLH256-301 aa

PF23177.2bHLH_IRO3258-312 aa

PF23173.3bHLH_SAC51259-303 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026884	`PF00010.32`	HLH	256	301	1.3e-14	54.4
LXL04_026884	`PF23177.2`	bHLH_IRO3	258	312	1.6e-06	29.1
LXL04_026884	`PF23173.3`	bHLH_SAC51	259	303	2.6e-07	31.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GZ38`	Arabidopsis thaliana	Transcription factor UNE10	45.578%	Swiss-Prot	moderate database homology
`O80536`	Arabidopsis thaliana	Transcription factor PIF3	44.660%	Swiss-Prot	weak database homology
`Q9FHA2`	Arabidopsis thaliana	Transcription factor ALC	53.933%	Swiss-Prot	weak database homology
`Q8GZM7`	Arabidopsis thaliana	Transcription factor PIF1	26.116%	Swiss-Prot	weak database homology
`Q0JNI9`	Oryza sativa subsp. japonica	Transcription factor PHYTOCHROME INTERACTING FACTOR-LIKE 15	55.422%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card