LXL04_026850 | RubberDandelionOmics

Gene overview

LXL04_026850

Reference: OH-1004 Chr: Chr06 Coordinates: 3757218-3761182 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1413 bp · LXL04_026850|LXL04_026850|OH1004|cDNA

ATGCCTACTACGGTCGACCTCCGTCGCTGCGTACTTCCTTCTCCGACCTCCGCAATCGTCGCCGTCGCTGTTGTACAGCCGCCGCCCCCATTCTATCCTTCATCGACGACACCTCTGTCGTCTTCTGTTCTATCTTCTTCGCCATCGCTCTCTACTAAATCATCATTCAAACTCGTTTCAAAAGTTTTTGAAGATCAGTTGATAGTCATGGCAGGGGAAGATGTTACGGACAGTGGTTTATCATGTGTTAAATGTGGCAA...

CDS

Download CDS FASTA

1413 bp · LXL04_026850|LXL04_026850|OH1004|CDS

ATGCCTACTACGGTCGACCTCCGTCGCTGCGTACTTCCTTCTCCGACCTCCGCAATCGTCGCCGTCGCTGTTGTACAGCCGCCGCCCCCATTCTATCCTTCATCGACGACACCTCTGTCGTCTTCTGTTCTATCTTCTTCGCCATCGCTCTCTACTAAATCATCATTCAAACTCGTTTCAAAAGTTTTTGAAGATCAGTTGATAGTCATGGCAGGGGAAGATGTTACGGACAGTGGTTTATCATGTGTTAAATGTGGCAA...

Protein

Download Protein FASTA

470 aa · LXL04_026850|LXL04_026850|OH1004|PROTEIN

MPTTVDLRRCVLPSPTSAIVAVAVVQPPPPFYPSSTTPLSSSVLSSSPSLSTKSSFKLVSKVFEDQLIVMAGEDVTDSGLSCVKCGKPAHLQCPKCVELKLPREGAAFCTQDCFKASWSSHKSVHLKAKLSSVGSSNPWELNIASPSDGWLYCLRKGQSRTAQIPHFDWTGPLRPYPISKKRVIPAGIELPDWALDGTPKIEPISDLQHVVEIKTPEQIERMRETSRIAREVLDAAARVVRPGVTTDEIDAVVHEATIAA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026850`
TK1151 ID	TkA07G010490
OH-1004 ID	LXL04_026850
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 85.319 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026850

Location Chr06:3757218-3761182 (-)

Description Similar to MAP1A: Methionine aminopeptidase 1A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45240`	Cotranslationally removes the N-terminal methionine from nascent proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026850 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0006882 intracellular zinc ion homeostasis Biological Process

GO:0016485 protein processing Biological Process

GO:0031365 N-terminal protein amino acid modification Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004239 initiator methionyl aminopeptidase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0070006 metalloaminopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT2G45240

ddi:DDB_G0279433

xla:399247

xtr:496944

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.460

Rank 1 · LXL04_026850 · OH-1004

Nucleus0.224

Rank 2 · LXL04_026850 · OH-1004

Plastid0.152

Rank 3 · LXL04_026850 · OH-1004

Mitochondrion0.104

Rank 4 · LXL04_026850 · OH-1004

Peroxisome0.096

Rank 5 · LXL04_026850 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15801.12zf-C6H283-126 aa

PF00557.30Peptidase_M24220-448 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026850	`PF15801.12`	zf-C6H2	83	126	1.7e-14	54.4
LXL04_026850	`PF00557.30`	Peptidase_M24	220	448	6e-54	183.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SLN5`	Arabidopsis thaliana	Methionine aminopeptidase 1A	83.548%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card