LXL04_026698 | RubberDandelionOmics

Gene overview

LXL04_026698

Reference: OH-1004 Chr: Chr06 Coordinates: 1553573-1558337 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1797 bp · LXL04_026698|LXL04_026698|OH1004|cDNA

ATGAAGGTAATTGAGAAGATTTTGGAGTCTACGGCGGCCGGAGATGCCGGAAAGGTTGTGTTTTCCTTCGAATTCTTCCCTCCCAAGACGGAGGAAGGTGTCGAGAATCTGTTCGAAAGGATGGAGCGTATGGTAGCTCACAATCCTACATTTTGCGATATCACATGGGGTGCCGGTGGTACCACGGCGGACCTGACTTTGGAAATAGCAAGAAGGATGCAGAACATGGTGTGTGTGGAGACTATGATGCATTTGACGTG...

CDS

Download CDS FASTA

1797 bp · LXL04_026698|LXL04_026698|OH1004|CDS

ATGAAGGTAATTGAGAAGATTTTGGAGTCTACGGCGGCCGGAGATGCCGGAAAGGTTGTGTTTTCCTTCGAATTCTTCCCTCCCAAGACGGAGGAAGGTGTCGAGAATCTGTTCGAAAGGATGGAGCGTATGGTAGCTCACAATCCTACATTTTGCGATATCACATGGGGTGCCGGTGGTACCACGGCGGACCTGACTTTGGAAATAGCAAGAAGGATGCAGAACATGGTGTGTGTGGAGACTATGATGCATTTGACGTG...

Protein

Download Protein FASTA

598 aa · LXL04_026698|LXL04_026698|OH1004|PROTEIN

MKVIEKILESTAAGDAGKVVFSFEFFPPKTEEGVENLFERMERMVAHNPTFCDITWGAGGTTADLTLEIARRMQNMVCVETMMHLTCTNMPVEKIDHALETIKKDGIQNVLALRGDPPRGQDKFVQIQGGFACALDLVEHIRKSYDDYFGIAVAGYPEAHPEVIESNGLATPDAYQKDLAYLKKKVDAGADVIVTQLFYDVENFLKFVNDCRQIGITCPIVPGIMPINNYNGFIRMTGFCKTRIPSEITAALEPIKDNEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026698`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026698

Location Chr06:1553573-1558337 (+)

Description Similar to Methylenetetrahydrofolate reductase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59970`	The probable reversibility of the MTHFR reaction in plants suggests that they can metabolize the methyl group of 5,10-methylenetetrahydrofolate to serine, sugars and starch.	No verified direct reference in this release
`At2g44160`	The probable reversibility of the MTHFR reaction in plants suggests that they can metabolize the methyl group of 5,10-methylenetetrahydrofolate to serine, sugars and starch.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0815200`	The probable reversibility of the MTHFR reaction in plants suggests that they can metabolize the methyl group of 5,10-methylenetetrahydrofolate to serine, sugars and starch.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026698 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001666 response to hypoxia Biological Process

GO:0006555 methionine metabolic process Biological Process

GO:0009086 methionine biosynthetic process Biological Process

GO:0009410 response to xenobiotic stimulus Biological Process

GO:0033274 response to vitamin B2 Biological Process

GO:0035999 tetrahydrofolate interconversion Biological Process

GO:0043200 response to amino acid Biological Process

GO:0046500 S-adenosylmethionine metabolic process Biological Process

GO:0050667 homocysteine metabolic process Biological Process

GO:0051593 response to folic acid Biological Process

GO:0070555 response to interleukin-1 Biological Process

GO:0070828 heterochromatin organization Biological Process

KEGG gene cross-reference

ath:AT2G44160

ath:AT3G59970

hsa:4524

zma:118474709

zma:541794

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.732

Rank 1 · LXL04_026698 · OH-1004

Nucleus0.269

Rank 2 · LXL04_026698 · OH-1004

Cell membrane0.086

Rank 3 · LXL04_026698 · OH-1004

Mitochondrion0.078

Rank 4 · LXL04_026698 · OH-1004

Endoplasmic reticulum0.071

Rank 5 · LXL04_026698 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02219.24MTHFR15-304 aa

PF21895.2MTHFR_C313-592 aa

PF21897.2DUF6919394-496 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026698	`PF02219.24`	MTHFR	15	304	1.8e-121	405.6
LXL04_026698	`PF21895.2`	MTHFR_C	313	592	3.1e-88	296.7
LXL04_026698	`PF21897.2`	DUF6919	394	496	9.1e-09	36.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SE60`	Arabidopsis thaliana	Methylenetetrahydrofolate reductase (NADH) 1	75.462%	Swiss-Prot	strong database homology
`O80585`	Arabidopsis thaliana	Methylenetetrahydrofolate reductase (NADH) 2	76.471%	Swiss-Prot	strong database homology
`Q75HE6`	Oryza sativa subsp. japonica	Probable methylenetetrahydrofolate reductase (NADH)	76.846%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card