LXL04_026677 | RubberDandelionOmics

Gene overview

LXL04_026677

Reference: OH-1004 Chr: Chr06 Coordinates: 1348871-1352056 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1407 bp · LXL04_026677|LXL04_026677|OH1004|cDNA

ATGTGTGAGGATTCAACGATGGTTTCCCCTTCCGTTGCTGTCGTTGAAGTTTTGAACTCAACAACAAGCGATGGAAAGAAATACATAACATCGGAAGAGTTACAAAAACACAACAAAGCCACCGACCTCTGGATCTCAATCCAAGGCAAAGTCTACAACGTGACCGAATGGTCCAAAATCCACCCGGGCGGCGACATCCCCCTCCTAAATCTCGCCGGTCAGGACGTGACCGATGCCTTCATCGCCTTCCATCCGGGGTC...

CDS

Download CDS FASTA

1407 bp · LXL04_026677|LXL04_026677|OH1004|CDS

ATGTGTGAGGATTCAACGATGGTTTCCCCTTCCGTTGCTGTCGTTGAAGTTTTGAACTCAACAACAAGCGATGGAAAGAAATACATAACATCGGAAGAGTTACAAAAACACAACAAAGCCACCGACCTCTGGATCTCAATCCAAGGCAAAGTCTACAACGTGACCGAATGGTCCAAAATCCACCCGGGCGGCGACATCCCCCTCCTAAATCTCGCCGGTCAGGACGTGACCGATGCCTTCATCGCCTTCCATCCGGGGTC...

Protein

Download Protein FASTA

468 aa · LXL04_026677|LXL04_026677|OH1004|PROTEIN

MCEDSTMVSPSVAVVEVLNSTTSDGKKYITSEELQKHNKATDLWISIQGKVYNVTEWSKIHPGGDIPLLNLAGQDVTDAFIAFHPGSAWHHLQSLFTGYHLKDYHVSDISKDYRKLASEFSKAGMFDKKGHGVIYSLCFVSILLSLCVYGVLFSTSTTVHMFAGALLGLAWMQIAYLGHDAGHYQMMSTRGWNKFAGIFIGNCITGISIAWWKWTHNAHHIACNSLDYDPDLQHLPMLAVSSKLFESITSVFYGRKLTFD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026677`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026677

Location Chr06:1348871-1352056 (+)

Description Similar to sld1: Delta(8)-fatty-acid desaturase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g46210`	May act as a Δ8 fatty-acid desaturase, introducing a double bond at position 8 of the ceramide long-chain base.	Sphingolipid Δ8 unsaturation is important for glucosylceramide biosynthesis and low-temperature performance in Arabidopsis.2012 · DOI: 10.1111/j.1365-313x.2011.04829.x
`At3g61580`	May act as a Δ8 fatty-acid desaturase, introducing a double bond at position 8 of the ceramide long-chain base.	Sphingolipid Δ8 unsaturation is important for glucosylceramide biosynthesis and low-temperature performance in Arabidopsis.2012 · DOI: 10.1111/j.1365-313x.2011.04829.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026677 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006629 lipid metabolic process Biological Process

GO:0006636 unsaturated fatty acid biosynthetic process Biological Process

GO:0006665 sphingolipid metabolic process Biological Process

GO:0030148 sphingolipid biosynthetic process Biological Process

GO:0070417 cellular response to cold Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0016717 oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0052631 sphingolipid 8-(E/Z)-desaturase activity Molecular Function

KEGG gene cross-reference

ag:AAC49700

ath:AT2G46210

ath:AT3G61580

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.737

Rank 1 · LXL04_026677 · OH-1004

Mitochondrion0.118

Rank 2 · LXL04_026677 · OH-1004

Cytoplasm0.077

Rank 3 · LXL04_026677 · OH-1004

Cell membrane0.062

Rank 4 · LXL04_026677 · OH-1004

Nucleus0.055

Rank 5 · LXL04_026677 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00173.34Cyt-b530-99 aa

PF00487.31FA_desaturase159-427 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026677	`PF00173.34`	Cyt-b5	30	99	1.3e-22	80.3
LXL04_026677	`PF00487.31`	FA_desaturase	159	427	7.7e-33	115.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3EBF7`	Arabidopsis thaliana	Delta(8)-fatty-acid desaturase 2	69.752%	Swiss-Prot	strong database homology
`Q9ZRP7`	Arabidopsis thaliana	Delta(8)-fatty-acid desaturase 1	69.526%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card