LXL04_026437 | RubberDandelionOmics

Gene overview

LXL04_026437

Reference: OH-1004 Chr: Chr05 Coordinates: 126314547-126316832 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1010 bp · LXL04_026437|LXL04_026437|OH1004|cDNA

TATGCCTTTAAGGAGCTACAAGTGGTATCGGTTTAGAAACCACACGCGTACTTGCCTTACGTGGGGTGCATGTAGTTATGCCGGTCAGAAACCTCGAATCTGGTAAAAAGGTGAAAGAAAGCATCACCGAAAAAATCCCTCATGCTAGAATTGATGTGATGGAGTTAGATATCAGCTCACTGCAATCCGTACGACAATTTGCTTTGCAGTATCGTGCAAAGGGGTATCCTTTGAACATCTTAATTCTAAATGCAGGGATT...

CDS

Download CDS FASTA

933 bp · LXL04_026437|LXL04_026437|OH1004|CDS

ATGCCGGTCAGAAACCTCGAATCTGGTAAAAAGGTGAAAGAAAGCATCACCGAAAAAATCCCTCATGCTAGAATTGATGTGATGGAGTTAGATATCAGCTCACTGCAATCCGTACGACAATTTGCTTTGCAGTATCGTGCAAAGGGGTATCCTTTGAACATCTTAATTCTAAATGCAGGGATTATGGCTCCTCCATTCTCTCTTAGCAAAGACAACATAGAATTGCAATTTGCAACAAACCATGTTGGTAACTTCCTTTT...

Protein

Download Protein FASTA

310 aa · LXL04_026437|LXL04_026437|OH1004|PROTEIN

MPVRNLESGKKVKESITEKIPHARIDVMELDISSLQSVRQFALQYRAKGYPLNILILNAGIMAPPFSLSKDNIELQFATNHVGNFLLTNLLLDTMKKTAKESGKEGRIVILSSEIHRMTYKEGIRFDKINDEKSYSALSAYGQSKLANALHAKELTRRFKEEGVNITANSLHPGVIATNLGRHSGFSSNSQPLHFHFHIFSKFVCSKMCFHKKQVIFSYANDLQIYCIGMAAFYGIFNRFLKNIPQGAATTCYVALHPQV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026437`
TK1151 ID	TkA06G010170
OH-1004 ID	LXL04_026437
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	86.500
Protein coverage (%)	TK1151 82.687 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026437

Location Chr05:126314547-126316832 (+)

Description Similar to TIC32: Short-chain dehydrogenase TIC 32, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g23430`	Involved in protein precursor import into chloroplasts.	Tic32, an essential component in chloroplast biogenesis.2004 · DOI: 10.1074/jbc.m402817200

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026437 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005765 lysosomal membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT4G23430

bna:106397857

hsa:57665

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.300

Rank 1 · LXL04_026437 · OH-1004

Cytoplasm0.222

Rank 2 · LXL04_026437 · OH-1004

Mitochondrion0.195

Rank 3 · LXL04_026437 · OH-1004

Peroxisome0.179

Rank 4 · LXL04_026437 · OH-1004

Nucleus0.084

Rank 5 · LXL04_026437 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106.32adh_short4-122 aa

PF13561.13adh_short_C210-183 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026437	`PF00106.32`	adh_short	4	122	3.2e-18	66.6
LXL04_026437	`PF13561.13`	adh_short_C2	10	183	2.2e-09	37.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A2RVM0`	Arabidopsis thaliana	Short-chain dehydrogenase TIC 32, chloroplastic	58.472%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card