LXL04_026234 | RubberDandelionOmics

Gene overview

LXL04_026234

Reference: OH-1004 Chr: Chr05 Coordinates: 123538273-123539910 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1638 bp · LXL04_026234|LXL04_026234|OH1004|cDNA

ATGAATTATATGAGTAAGAGCACCGGCGGTGATAGTGGTAGTAGCACTAGTAGTAGAAGACAACAGATACAGGGAGGAGGCGGCGGcggtggaggaggaggaggaggtggaggaGGGAATTTGtttgaagaagaagacgaagaagaaagaCAAAACACGGCCCCAGCAGGTCAGTTATTcccttcttcttcatcttcttcccCATCTTCTTCTCATCATCATCAACATCAAAATCAACAACATCAACATCAACATAAACA...

CDS

Download CDS FASTA

1638 bp · LXL04_026234|LXL04_026234|OH1004|CDS

ATGAATTATATGAGTAAGAGCACCGGCGGTGATAGTGGTAGTAGCACTAGTAGTAGAAGACAACAGATACAGGGAGGAGGCGGCGGCGGTGGAGGAGGAGGAGGAGGTGGAGGAGGGAATTTGTTTGAAGAAGAAGACGAAGAAGAAAGACAAAACACGGCCCCAGCAGGTCAGTTATTCCCTTCTTCTTCATCTTCTTCCCCATCTTCTTCTCATCATCATCAACATCAAAATCAACAACATCAACATCAACATAAACA...

Protein

Download Protein FASTA

545 aa · LXL04_026234|LXL04_026234|OH1004|PROTEIN

MNYMSKSTGGDSGSSTSSRRQQIQGGGGGGGGGGGGGGGNLFEEEDEEERQNTAPAGQLFPSSSSSSPSSSHHHQHQNQQHQHQHKHHQPPAFLHHPPYHHQNQRGGWVFDGASLHGGEPSSRPISTDPMSMDYSSVPPPPAPDNTNDDEHQGGGMMMVVEREHMFDKVVTPSDVGKLNRLVIPKQHAERYFPLDSSTNDKGLLLNFEDRNGKPWRFRYSYWNSSQSYVMTKGWSRFVKDKKLDAGDIVSFQRGVGGSAK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026234`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026234

Location Chr05:123538273-123539910 (-)

Description Similar to Os03g0120900: B3 domain-containing protein Os03g0120900

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g46870`	Regulates lateral organ growth.	No verified direct reference in this release
`At1g01030`	Regulates lateral organ growth.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0120900`	B3 domain-containing protein Os03g0120900.	No verified direct reference in this release
`Os02g0683500`	B3 domain-containing protein Os02g0683500.	No verified direct reference in this release
`Os04g0581400`	B3 domain-containing protein Os04g0581400.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026234 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009908 flower development Biological Process

GO:0048366 leaf development Biological Process

GO:0048480 stigma development Biological Process

GO:1901371 regulation of leaf morphogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G01030

ath:AT2G46870

dosa:Os02g0683500

dosa:Os03g0120900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.942

Rank 1 · LXL04_026234 · OH-1004

Cytoplasm0.119

Rank 2 · LXL04_026234 · OH-1004

Endoplasmic reticulum0.053

Rank 3 · LXL04_026234 · OH-1004

Cell membrane0.043

Rank 4 · LXL04_026234 · OH-1004

Plastid0.011

Rank 5 · LXL04_026234 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02362.27B3166-253 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026234	`PF02362.27`	B3	166	253	5.6e-26	91.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82799`	Arabidopsis thaliana	B3 domain-containing transcription factor NGA1	67.485%	Swiss-Prot	weak database homology
`Q9MAN1`	Arabidopsis thaliana	B3 domain-containing transcription factor NGA3	83.333%	Swiss-Prot	weak database homology
`Q8LMR9`	Oryza sativa subsp. japonica	B3 domain-containing protein Os03g0120900	44.937%	Swiss-Prot	moderate database homology
`Q6EU30`	Oryza sativa subsp. japonica	B3 domain-containing protein Os02g0683500	46.667%	Swiss-Prot	moderate database homology
`Q7F9W2`	Oryza sativa subsp. japonica	B3 domain-containing protein Os04g0581400	56.701%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card