LXL04_026138 | RubberDandelionOmics

Gene overview

LXL04_026138

Reference: OH-1004 Chr: Chr05 Coordinates: 121634101-121635870 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

915 bp · LXL04_026138|LXL04_026138|OH1004|cDNA

ATGGAAACTTGTAGGAGGCTGGAACGACCCACCCACCCAAATTTCTCCTACAAGTACCTTCTCCTTTCTTCGCCGCCTCCACTCTCTCTCGGTCTACAACTCTCTTTTACTCTCTCGCTCTACAGTCatcccaccaccaccaccgttGCCGCCGCCCTTGCTACTGTCAAACTGGCGATCGATAATCAGGAAGCCACCATCGTTCGTGAAATCAAACCCAAGAACCGCCGGATTATGGGTGCCGGAGGACCTGATGAAGA...

CDS

Download CDS FASTA

915 bp · LXL04_026138|LXL04_026138|OH1004|CDS

ATGGAAACTTGTAGGAGGCTGGAACGACCCACCCACCCAAATTTCTCCTACAAGTACCTTCTCCTTTCTTCGCCGCCTCCACTCTCTCTCGGTCTACAACTCTCTTTTACTCTCTCGCTCTACAGTCATCCCACCACCACCACCGTTGCCGCCGCCCTTGCTACTGTCAAACTGGCGATCGATAATCAGGAAGCCACCATCGTTCGTGAAATCAAACCCAAGAACCGCCGGATTATGGGTGCCGGAGGACCTGATGAAGA...

Protein

Download Protein FASTA

304 aa · LXL04_026138|LXL04_026138|OH1004|PROTEIN

METCRRLERPTHPNFSYKYLLLSSPPPLSLGLQLSFTLSLYSHPTTTTVAAALATVKLAIDNQEATIVREIKPKNRRIMGAGGPDEEEQKWPPWLKPMLRESFFVQCKLHAESHKSECNMYCLDCMNGPLCSLCLNHHKDHRAIQIRRSSYHDVIRVSEIQKYLDISSVQTYIINSAKVVFLNERPQPRPGKGVTNTCEVCERSLLDSFRFCSLGCKIVGTSTNFERKSKISPEKKLLMMAISDSEDSYSSNSHGRHRSN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026138`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026138

Location Chr05:121634101-121635870 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g12646`	May participate in RGF1 peptide signaling regulating root meristem size and root growth.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026138 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010078 maintenance of root meristem identity Biological Process

GO:0043434 response to peptide hormone Biological Process

GO:2000280 regulation of root development Biological Process

GO:2000377 regulation of reactive oxygen species metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G12646

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.830

Rank 1 · LXL04_026138 · OH-1004

Cytoplasm0.195

Rank 2 · LXL04_026138 · OH-1004

Cell membrane0.062

Rank 3 · LXL04_026138 · OH-1004

Endoplasmic reticulum0.041

Rank 4 · LXL04_026138 · OH-1004

Lysosome / Vacuole0.016

Rank 5 · LXL04_026138 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04640.20PLATZ147-218 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026138	`PF04640.20`	PLATZ	147	218	7.6e-32	110.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q1G3Q4`	Arabidopsis thaliana	Protein RGF1 INDUCIBLE TRANSCRIPTION FACTOR 1	49.606%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card