LXL04_025989 | RubberDandelionOmics

Gene overview

LXL04_025989

Reference: OH-1004 Chr: Chr05 Coordinates: 119416932-119418660 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

657 bp · LXL04_025989|LXL04_025989|OH1004|cDNA

ATGGACAAGCTGCTAAGCGTCGGAACTAAGATCGTCGGCGTCGGCCGTAATTACGCCGCTCACGCAAAGGAACTCGGAAACGCCGTCCCCAAGGAGCCGGTATTGTTTTTGAAGCCTACATCCTCCTACTTGGAAAATGGTGGAACGATCGAAGTTCCTCATCCGTTGGAATCGCTCGATCACGAGGTGGAGCTGGCGGTAGTTATTAGCAAAAAGGCTCGCGATGTTCCTGAATCTTCTGCCATGAGTTATATCGGAGG...

CDS

Download CDS FASTA

657 bp · LXL04_025989|LXL04_025989|OH1004|CDS

ATGGACAAGCTGCTAAGCGTCGGAACTAAGATCGTCGGCGTCGGCCGTAATTACGCCGCTCACGCAAAGGAACTCGGAAACGCCGTCCCCAAGGAGCCGGTATTGTTTTTGAAGCCTACATCCTCCTACTTGGAAAATGGTGGAACGATCGAAGTTCCTCATCCGTTGGAATCGCTCGATCACGAGGTGGAGCTGGCGGTAGTTATTAGCAAAAAGGCTCGCGATGTTCCTGAATCTTCTGCCATGAGTTATATCGGAGG...

Protein

Download Protein FASTA

218 aa · LXL04_025989|LXL04_025989|OH1004|PROTEIN

MDKLLSVGTKIVGVGRNYAAHAKELGNAVPKEPVLFLKPTSSYLENGGTIEVPHPLESLDHEVELAVVISKKARDVPESSAMSYIGGYALALDMTAREIQASAKSAGLPWTIAKGQDTFTPISSILSLSRVPDPHSVELWLKVDGEIRQKGSTEDMIFKIPFLISHISSIMTLLEGDVILTGTPKGVGPVKVGQRIEAGITGILDMNFDVGRRQKTMQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025989`
TK1151 ID	TkA06G039320
OH-1004 ID	LXL04_025989
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025989

Location Chr05:119416932-119418660 (+)

Description Similar to FAHD1: Probable acylpyruvase FAHD1, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g15940`	Tautomerase that converts enol-oxaloacetate, a strong inhibitor of succinate dehydrogenase, to the physiological keto form of oxaloacetate.	No verified direct reference in this release
`At3g16700`	Tautomerase that converts enol-oxaloacetate, a strong inhibitor of succinate dehydrogenase, to the physiological keto form of oxaloacetate.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0829000`	Tautomerase that converts enol-oxaloacetate, a strong inhibitor of succinate dehydrogenase, to the physiological keto form of oxaloacetate.	No verified direct reference in this release
`Os03g0421500`	Tautomerase that converts enol-oxaloacetate, a strong inhibitor of succinate dehydrogenase, to the physiological keto form of oxaloacetate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025989 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006107 oxaloacetate metabolic process Biological Process

GO:0019752 carboxylic acid metabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005507 copper ion binding Molecular Function

GO:0008948 oxaloacetate decarboxylase activity Molecular Function

GO:0018773 acetylpyruvate hydrolase activity Molecular Function

GO:0034545 fumarylpyruvate hydrolase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0047621 acylpyruvate hydrolase activity Molecular Function

GO:0050163 oxaloacetate tautomerase activity Molecular Function

KEGG gene cross-reference

ath:AT3G16700

ath:AT4G15940

ddi:DDB_G0275071

dosa:Os03g0421500

dosa:Os03g0421700

dosa:Os03g0829000

osa:4334655

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.502

Rank 1 · LXL04_025989 · OH-1004

Cytoplasm0.314

Rank 2 · LXL04_025989 · OH-1004

Nucleus0.130

Rank 3 · LXL04_025989 · OH-1004

Peroxisome0.109

Rank 4 · LXL04_025989 · OH-1004

Plastid0.105

Rank 5 · LXL04_025989 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01557.24FAA_hydrolase10-208 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025989	`PF01557.24`	FAA_hydrolase	10	208	3.3e-62	210.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93ZE5`	Arabidopsis thaliana	Oxaloacetate tautomerase FAHD1, mitochondrial	76.498%	Swiss-Prot	strong database homology
`Q9LUR3`	Arabidopsis thaliana	Oxaloacetate tautomerase FAHD2, mitochondrial	72.811%	Swiss-Prot	strong database homology
`Q10B63`	Oryza sativa subsp. japonica	Oxaloacetate tautomerase FAHD2, mitochondrial	72.642%	Swiss-Prot	strong database homology
`A3AJ77`	Oryza sativa subsp. japonica	Oxaloacetate tautomerase FAHD1, mitochondrial	71.698%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card