LXL04_025973 | RubberDandelionOmics

Gene overview

LXL04_025973

Reference: OH-1004 Chr: Chr05 Coordinates: 119282224-119287222 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3126 bp · LXL04_025973|LXL04_025973|OH1004|cDNA

ATGGAGCGTGCCCGAAGGCTAGCAAACAAAGCCATCCTCGGCCGCCTGGTTTCACAAACCAAACAAAACCCATCGTCCCCAGCTCTCTATTCTCCGTCGAGGTATGTCTCCTCTCTATCCCCGTATGTATGTAGCGGTAGTGGCCGAAACGTTAGATCAGAGAGAACCATTAATGGTTTCGGTCCGAATTCGAATTCGCAAGTTCGATCTATATCAGTAGACGCATTAAAACCCAGTGACACTTTCGCACGCCGCCATAA...

CDS

Download CDS FASTA

3126 bp · LXL04_025973|LXL04_025973|OH1004|CDS

ATGGAGCGTGCCCGAAGGCTAGCAAACAAAGCCATCCTCGGCCGCCTGGTTTCACAAACCAAACAAAACCCATCGTCCCCAGCTCTCTATTCTCCGTCGAGGTATGTCTCCTCTCTATCCCCGTATGTATGTAGCGGTAGTGGCCGAAACGTTAGATCAGAGAGAACCATTAATGGTTTCGGTCCGAATTCGAATTCGCAAGTTCGATCTATATCAGTAGACGCATTAAAACCCAGTGACACTTTCGCACGCCGCCATAA...

Protein

Download Protein FASTA

1041 aa · LXL04_025973|LXL04_025973|OH1004|PROTEIN

MERARRLANKAILGRLVSQTKQNPSSPALYSPSRYVSSLSPYVCSGSGRNVRSERTINGFGPNSNSQVRSISVDALKPSDTFARRHNSATPEEQTKMAEFVGFPNLDSLIDATVPKSIRLESMKFPKFDEGLTESQMIAHMQDLASKNKIYKSFIGMGYYNTSVPPVILRNIMENPGWYTQYTPYQAEIAQGRLESLLNFQTMITDLTGLPMSNASLLDEGTAAAEAMAMCNNIQKGKKKTFIIASNCHPQTIEICKTRA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025973`
TK1151 ID	TkA06G038780
OH-1004 ID	LXL04_025973
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.077 / OH-1004 51.585 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_025973`
Location	Chr05:119282224-119287222 (+)
Description	Similar to GDCSPA: Glycine dehydrogenase (decarboxylating) A, mitochondrial
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025973` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0019464 glycine decarboxylation via glycine cleavage system Biological Process GO:0005739 mitochondrion Cellular Component GO:0005960 glycine cleavage complex Cellular Component GO:0009941 chloroplast envelope Cellular Component GO:0048046 apoplast Cellular Component GO:0004375 glycine dehydrogenase (decarboxylating) activity Molecular Function GO:0016594 glycine binding Molecular Function GO:0030170 pyridoxal phosphate binding Molecular Function
KEGG gene cross-reference	sot:102601213 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.883

Rank 1 · LXL04_025973 · OH-1004

Cytoplasm0.096

Rank 2 · LXL04_025973 · OH-1004

Nucleus0.052

Rank 3 · LXL04_025973 · OH-1004

Plastid0.035

Rank 4 · LXL04_025973 · OH-1004

Cell membrane0.022

Rank 5 · LXL04_025973 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02347.23GDC-P85-511 aa

PF02347.23GDC-P529-804 aa

PF21478.4GcvP2_C855-976 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025973	`PF02347.23`	GDC-P	85	511	9.9e-199	661.3
LXL04_025973	`PF02347.23`	GDC-P	529	804	9.9e-199	661.3
LXL04_025973	`PF21478.4`	GcvP2_C	855	976	4.7e-59	198.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card