LXL04_025707 | RubberDandelionOmics

Gene overview

LXL04_025707

Reference: OH-1004 Chr: Chr05 Coordinates: 115630759-115632915 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2157 bp · LXL04_025707|LXL04_025707|OH1004|cDNA

ATGAAGCGTTCTACCGATGACCTAGGTGAGAAATTGCAGGCAAAGAAACCCGTGTTTCTCACTAAAGCAGAGCGAGAACAATTAGCCCTCAAGCGCCGTCAAGATGAATTTGAAGAACAGAAGCGCAAATCCGAACAGCTTCTTCTCCAGAGTAACCCTAATTCTTCCTCCTCTAAACCCCCTCAGTCGTCCGATGACGCTTCCCGTAACCACCGGTCTTCTCGTGATTACGATCGCGACCGTGACCGTGATCGCCGTGA...

CDS

Download CDS FASTA

2157 bp · LXL04_025707|LXL04_025707|OH1004|CDS

ATGAAGCGTTCTACCGATGACCTAGGTGAGAAATTGCAGGCAAAGAAACCCGTGTTTCTCACTAAAGCAGAGCGAGAACAATTAGCCCTCAAGCGCCGTCAAGATGAATTTGAAGAACAGAAGCGCAAATCCGAACAGCTTCTTCTCCAGAGTAACCCTAATTCTTCCTCCTCTAAACCCCCTCAGTCGTCCGATGACGCTTCCCGTAACCACCGGTCTTCTCGTGATTACGATCGCGACCGTGACCGTGATCGCCGTGA...

Protein

Download Protein FASTA

718 aa · LXL04_025707|LXL04_025707|OH1004|PROTEIN

MKRSTDDLGEKLQAKKPVFLTKAEREQLALKRRQDEFEEQKRKSEQLLLQSNPNSSSSKPPQSSDDASRNHRSSRDYDRDRDRDRRDRDRDRDRDRERERERERERERERDSERRNRDRERDEEHKARERARLEKLAEREREKELDAIKEQYLGSKKPKKRVIKPSEKFRFSFDWENTEDTSRDMNVLYQNPHEARLLFGRGFRAGMDRREQKKLAAKNEKELRDEIRKKDGIEERPEEAAAQRLKEEAADMYDTFDMRV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025707`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025707

Location Chr05:115630759-115632915 (+)

Description Similar to RH21: DEAD-box ATP-dependent RNA helicase 21

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g33730`	ATP-dependent RNA helicase involved in mRNA splicing.	No verified direct reference in this release
`At1g28180`	Putative DEAD-box ATP-dependent RNA helicase 44.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0708600`	ATP-dependent RNA helicase involved in mRNA splicing.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025707 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000244 spliceosomal tri-snRNP complex assembly Biological Process

GO:0000354 cis assembly of pre-catalytic spliceosome Biological Process

GO:0000375 RNA splicing, via transesterification reactions Biological Process

GO:0000387 spliceosomal snRNP assembly Biological Process

GO:0000388 spliceosome conformational change to release U4 (or U4atac) and U1 (or U11) Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0008380 RNA splicing Biological Process

GO:0035196 miRNA processing Biological Process

GO:0062176 R-loop processing Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G33730

dosa:Os03g0708600

hsa:9416

osa:4333866

pon:100172249

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.935

Rank 1 · LXL04_025707 · OH-1004

Cytoplasm0.173

Rank 2 · LXL04_025707 · OH-1004

Cell membrane0.019

Rank 3 · LXL04_025707 · OH-1004

Mitochondrion0.014

Rank 4 · LXL04_025707 · OH-1004

Endoplasmic reticulum0.011

Rank 5 · LXL04_025707 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25430.2DDX23171-254 aa

PF00270.36DEAD322-512 aa

PF00271.38Helicase_C548-656 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025707	`PF25430.2`	DDX23	171	254	5.8e-22	79.1
LXL04_025707	`PF00270.36`	DEAD	322	512	7.9e-49	166.3
LXL04_025707	`PF00271.38`	Helicase_C	548	656	6.8e-36	123.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93008`	Arabidopsis thaliana	DEAD-box ATP-dependent RNA helicase 21	87.184%	Swiss-Prot	strong database homology
`Q9FZ92`	Arabidopsis thaliana	Putative DEAD-box ATP-dependent RNA helicase 44	60.201%	Swiss-Prot	strong database homology
`Q53RK8`	Oryza sativa subsp. japonica	DEAD-box ATP-dependent RNA helicase 21	84.550%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card