LXL04_025440 | RubberDandelionOmics

Gene overview

LXL04_025440

Reference: OH-1004 Chr: Chr05 Coordinates: 111823183-111824708 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

558 bp · LXL04_025440|LXL04_025440|OH1004|cDNA

ATGCAACTCGGAGCCTACTTTGCTTTCCAGCATCTATTCAATGATGTTCGCGAATCAACGGAAGATCATGGTCATGGCGGACTGATTTCTCAATGTCGGGCTTGTGTAGACGTCTTCTGGTGGTCACCGCATTTTGTATTCCCTTGTAATCCGCCACAAATTCAGGAAGTGGATGCTCTTGCGGAGATAAAGCCATACTTAATCTTTTGTTTGGTGGATGGAAGAGTGAAGATGGAAAATTGGGGTGTGGTTATTCAAGT...

CDS

Download CDS FASTA

558 bp · LXL04_025440|LXL04_025440|OH1004|CDS

ATGCAACTCGGAGCCTACTTTGCTTTCCAGCATCTATTCAATGATGTTCGCGAATCAACGGAAGATCATGGTCATGGCGGACTGATTTCTCAATGTCGGGCTTGTGTAGACGTCTTCTGGTGGTCACCGCATTTTGTATTCCCTTGTAATCCGCCACAAATTCAGGAAGTGGATGCTCTTGCGGAGATAAAGCCATACTTAATCTTTTGTTTGGTGGATGGAAGAGTGAAGATGGAAAATTGGGGTGTGGTTATTCAAGT...

Protein

Download Protein FASTA

185 aa · LXL04_025440|LXL04_025440|OH1004|PROTEIN

MQLGAYFAFQHLFNDVRESTEDHGHGGLISQCRACVDVFWWSPHFVFPCNPPQIQEVDALAEIKPYLIFCLVDGRVKMENWGVVIQVLGVLYAAESLKENLFKNLMNHSEFLTNTKLAISKTYKQTNLDFLESGKDTFCDDGLTASTTILVGNHLYVANVGDSRTVISKLENAIPLFVAVCCCRI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025440`
TK1151 ID	TkA06G058780
OH-1004 ID	LXL04_025440
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.900
Protein coverage (%)	TK1151 100.000 / OH-1004 95.676 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025440

Location Chr05:111823183-111824708 (-)

Description Similar to At5g53140: Probable protein phosphatase 2C 76

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g53140`	Probable protein phosphatase 2C 76.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0587100`	Probable protein phosphatase 2C 52.	No verified direct reference in this release
`Os02g0255100`	Probable protein phosphatase that may play a role as a mitochondrial signal transduction mediator in pollen germination.	DCW11, down-regulated gene 11 in CW-type cytoplasmic male sterile rice, encoding mitochondrial protein phosphatase 2c is related to cytoplasmic male sterility.2008 · DOI: 10.1093/pcp/pcn036
`Os01g0618200`	Probable protein phosphatase 2C 7.	No verified direct reference in this release
`UniProt: Q0DBU3`	Probable protein phosphatase 2C 56.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025440 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0009846 pollen germination Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT5G53140

dosa:Os02g0255100

dosa:Os05g0587100

dosa:Os06g0526800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.433

Rank 1 · LXL04_025440 · OH-1004

Nucleus0.305

Rank 2 · LXL04_025440 · OH-1004

Mitochondrion0.155

Rank 3 · LXL04_025440 · OH-1004

Endoplasmic reticulum0.104

Rank 4 · LXL04_025440 · OH-1004

Cell membrane0.101

Rank 5 · LXL04_025440 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481.27PP2C93-174 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025440	`PF00481.27`	PP2C	93	174	3.6e-09	37.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AT1`	Arabidopsis thaliana	Probable protein phosphatase 2C 76	67.045%	Swiss-Prot	weak database homology
`Q6L5C4`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 52	68.182%	Swiss-Prot	weak database homology
`Q6EN45`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C member 13, mitochondrial	59.406%	Swiss-Prot	moderate database homology
`Q0JL75`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 7	57.955%	Swiss-Prot	weak database homology
`Q0DBU3`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 56	61.798%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card