LXL04_025434 | RubberDandelionOmics

Gene overview

LXL04_025434

Reference: OH-1004 Chr: Chr05 Coordinates: 111632784-111634902 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1530 bp · LXL04_025434|LXL04_025434|OH1004|cDNA

ATGAAATCAACCACTGCAATGGAAACAAGATCTGCCAAGAGACGGAAGATGCTTTGTAGTCCCGAACATTCATCGGAAAACAACACCGGCGAAGATCGCATCACTGACCTTCCCAACGCCGTTCTTCACCACATTCTCCGCCTTCTCCCCATCAAATCCATCGTACAAACAACCATCTTATCTAAACGATGGAATGCTCTCTGGCACACCTTCCCTGATCTCGATTTCACCACCATATTCCCATCTGGAACTCCATTAAC...

CDS

Download CDS FASTA

1530 bp · LXL04_025434|LXL04_025434|OH1004|CDS

ATGAAATCAACCACTGCAATGGAAACAAGATCTGCCAAGAGACGGAAGATGCTTTGTAGTCCCGAACATTCATCGGAAAACAACACCGGCGAAGATCGCATCACTGACCTTCCCAACGCCGTTCTTCACCACATTCTCCGCCTTCTCCCCATCAAATCCATCGTACAAACAACCATCTTATCTAAACGATGGAATGCTCTCTGGCACACCTTCCCTGATCTCGATTTCACCACCATATTCCCATCTGGAACTCCATTAAC...

Protein

Download Protein FASTA

509 aa · LXL04_025434|LXL04_025434|OH1004|PROTEIN

MKSTTAMETRSAKRRKMLCSPEHSSENNTGEDRITDLPNAVLHHILRLLPIKSIVQTTILSKRWNALWHTFPDLDFTTIFPSGTPLTKFLSLNKKKNIGNVITKILSFREKLSDVRILRFYACMSFSGLHALIRSAVRVQVQELDITIATNDTFNFPRSIITSDNLRVLKVKSYPGLRLPPSRIMQSGFQKLRTLLLSFVYLDNQSSLMDLFTDCSFPQLTKLYLDSCFNLEQLRVGCRLLEELAVENCSSLQGLEIMSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025434`
TK1151 ID	TkA06G059380
OH-1004 ID	LXL04_025434
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025434

Location Chr05:111632784-111634902 (+)

Description Similar to At4g03220: Putative F-box/FBD/LRR-repeat protein At4g03220

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g03220`	Putative F-box/FBD/LRR-repeat protein At4g03220.	No verified direct reference in this release
`At5g22730`	FBD-associated F-box protein At5g22730.	No verified direct reference in this release
`At1g66290`	Putative F-box/FBD/LRR-repeat protein At1g66290.	No verified direct reference in this release
`At3g18150`	Putative F-box/LRR-repeat protein At3g18150.	No verified direct reference in this release
`At5g44950`	Putative F-box/FBD/LRR-repeat protein At5g44950.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025434 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G66290

ath:AT3G18150

ath:AT4G03220

ath:AT5G22730

ath:AT5G44950

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.908

Rank 1 · LXL04_025434 · OH-1004

Cytoplasm0.131

Rank 2 · LXL04_025434 · OH-1004

Cell membrane0.034

Rank 3 · LXL04_025434 · OH-1004

Endoplasmic reticulum0.026

Rank 4 · LXL04_025434 · OH-1004

Plastid0.014

Rank 5 · LXL04_025434 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646.39F-box34-71 aa

PF24758.2LRR_At5g56370215-301 aa

PF08387.16FBD437-473 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025434	`PF00646.39`	F-box	34	71	1.4e-07	31.9
LXL04_025434	`PF24758.2`	LRR_At5g56370	215	301	4.5e-10	40.3
LXL04_025434	`PF08387.16`	FBD	437	473	4.3e-07	30.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZR09`	Arabidopsis thaliana	Putative F-box/FBD/LRR-repeat protein At4g03220	40.657%	Swiss-Prot	moderate database homology
`Q9FNI8`	Arabidopsis thaliana	FBD-associated F-box protein At5g22730	24.894%	Swiss-Prot	weak database homology
`Q9C8Y8`	Arabidopsis thaliana	Putative F-box/FBD/LRR-repeat protein At1g66290	24.335%	Swiss-Prot	weak database homology
`Q9LV26`	Arabidopsis thaliana	Putative F-box/LRR-repeat protein At3g18150	22.515%	Swiss-Prot	weak database homology
`Q9FLA2`	Arabidopsis thaliana	Putative F-box/FBD/LRR-repeat protein At5g44950	25.895%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card