LXL04_025402 | RubberDandelionOmics

Gene overview

LXL04_025402

Reference: OH-1004 Chr: Chr05 Coordinates: 111109120-111110180 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

741 bp · LXL04_025402|LXL04_025402|OH1004|cDNA

ATGGCGACTCAAATAAGCAAGAAAAGAAAGTTTGTAGCAGACGGAGTGTTCTTTGCTGAGCTGAATGAGGTCCTTACAAGAGAGCTAGCAGAAGATGGATACTCTGGTGTTGAAGTTAGGGTTACACCCATGCGCACAGAGATCATCATCAGGGCCACCCGTACCCAAAACGTTCTTGGTGAAAAGGGAAGAAGAATAAGAGAGCTGACATCACTTGTCCAGAAAAGATTCAAGTTTCCAGAAAACAGTGTTGAGCTTTA...

CDS

Download CDS FASTA

741 bp · LXL04_025402|LXL04_025402|OH1004|CDS

ATGGCGACTCAAATAAGCAAGAAAAGAAAGTTTGTAGCAGACGGAGTGTTCTTTGCTGAGCTGAATGAGGTCCTTACAAGAGAGCTAGCAGAAGATGGATACTCTGGTGTTGAAGTTAGGGTTACACCCATGCGCACAGAGATCATCATCAGGGCCACCCGTACCCAAAACGTTCTTGGTGAAAAGGGAAGAAGAATAAGAGAGCTGACATCACTTGTCCAGAAAAGATTCAAGTTTCCAGAAAACAGTGTTGAGCTTTA...

Protein

Download Protein FASTA

246 aa · LXL04_025402|LXL04_025402|OH1004|PROTEIN

MATQISKKRKFVADGVFFAELNEVLTRELAEDGYSGVEVRVTPMRTEIIIRATRTQNVLGEKGRRIRELTSLVQKRFKFPENSVELYAERVNNRGLCAIAQAESLRYKLLGGLAVRRACYGVLRFVMENGAKGCEVIVSGKLRAQRAKSMKFKDGYMVSSGQPVKEYIDSAVRHVLLRQGVLGIKVKIMLDWDPTGKVGPKIPLPDNVIIHMPKDDVIALPPKEVEEYRPPLVADDPLPMPMAVPV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025402`
TK1151 ID	TkA06G061620
OH-1004 ID	LXL04_025402
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 82.787 / OH-1004 41.057 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025402

Location Chr05:111109120-111110180 (+)

Description Similar to RPS3A: 40S ribosomal protein S3-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g31610`	Small ribosomal subunit protein uS3z.	No verified direct reference in this release
`At5g35530`	Small ribosomal subunit protein uS3x.	No verified direct reference in this release
`At3g53870`	Small ribosomal subunit protein uS3y.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025402 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002181 cytoplasmic translation Biological Process

GO:0002183 cytoplasmic translational initiation Biological Process

GO:0006281 DNA repair Biological Process

GO:0006284 base-excision repair Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006412 translation Biological Process

GO:0006417 regulation of translation Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007059 chromosome segregation Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0017148 negative regulation of translation Biological Process

GO:0031116 positive regulation of microtubule polymerization Biological Process

KEGG gene cross-reference

ath:AT2G31610

ath:AT3G53870

ath:AT5G35530

hsa:6188

ssc:733671

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.863

Rank 1 · LXL04_025402 · OH-1004

Nucleus0.277

Rank 2 · LXL04_025402 · OH-1004

Endoplasmic reticulum0.093

Rank 3 · LXL04_025402 · OH-1004

Cell membrane0.033

Rank 4 · LXL04_025402 · OH-1004

Mitochondrion0.027

Rank 5 · LXL04_025402 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07650.24KH_220-94 aa

PF00189.26Ribosomal_S3_C106-188 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025402	`PF07650.24`	KH_2	20	94	5.6e-15	55.6
LXL04_025402	`PF00189.26`	Ribosomal_S3_C	106	188	5.3e-27	94.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SIP7`	Arabidopsis thaliana	Small ribosomal subunit protein uS3z	91.964%	Swiss-Prot	strong database homology
`Q9FJA6`	Arabidopsis thaliana	Small ribosomal subunit protein uS3x	83.871%	Swiss-Prot	strong database homology
`Q9M339`	Arabidopsis thaliana	Small ribosomal subunit protein uS3y	92.130%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card