LXL04_025298 | RubberDandelionOmics

Gene overview

LXL04_025298

Reference: OH-1004 Chr: Chr05 Coordinates: 109429551-109430691 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

804 bp · LXL04_025298|LXL04_025298|OH1004|cDNA

ATGAATCAAACCTACAAACACACCGCAAAAACAATGTCAATATTTCTCTACTTTCTGTTTACTCTTCCCGTAATTGCCTCCACAAATGCTTGTGATAGATGCCTGCATCAAACTAAAGCACTTCTCTTCTCCAATGCTTCGGCCCTTTCATATGGAGCATGTGGGTATGGTTCATCTGCTCCAAGCTTCTACAATGGCCATCTTGCTGCTGCTCTTCCCAGCATTTTCAAATCCGGGTCGGGTTGTGGTGCTTGTTTCCA...

CDS

Download CDS FASTA

804 bp · LXL04_025298|LXL04_025298|OH1004|CDS

ATGAATCAAACCTACAAACACACCGCAAAAACAATGTCAATATTTCTCTACTTTCTGTTTACTCTTCCCGTAATTGCCTCCACAAATGCTTGTGATAGATGCCTGCATCAAACTAAAGCACTTCTCTTCTCCAATGCTTCGGCCCTTTCATATGGAGCATGTGGGTATGGTTCATCTGCTCCAAGCTTCTACAATGGCCATCTTGCTGCTGCTCTTCCCAGCATTTTCAAATCCGGGTCGGGTTGTGGTGCTTGTTTCCA...

Protein

Download Protein FASTA

267 aa · LXL04_025298|LXL04_025298|OH1004|PROTEIN

MNQTYKHTAKTMSIFLYFLFTLPVIASTNACDRCLHQTKALLFSNASALSYGACGYGSSAPSFYNGHLAAALPSIFKSGSGCGACFQVRCMDAKLCSKFGTQVIVTDLNNNKQTDLVLSSRALMAMANKGMEQNLLKLGAAKVEYKRVPCDYKGKNLAMRVEESSRKPNYLAIKFLYQGGQTEIVSVDVAQVGATSWGFLRRKSGAIWETSRVPAGALQFRLAVTSGYDRKAIWAKSVLPADWNAGIVYDSGVQIDDVAE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025298`
TK1151 ID	TkA06G069030
OH-1004 ID	LXL04_025298
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025298

Location Chr05:109429551-109430691 (-)

Description Similar to EXLA1: Expansin-like A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g45970`	Expansin-like A1.	No verified direct reference in this release
`At3g45960`	Expansin-like A3.	No verified direct reference in this release
`At4g38400`	Expansin-like A2.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0542400`	Expansin-like A2.	No verified direct reference in this release
`Os03g0132200`	Expansin-like A1.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025298 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009826 unidimensional cell growth Biological Process

GO:0009828 plant-type cell wall loosening Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

GO:0099503 secretory vesicle Cellular Component

KEGG gene cross-reference

ath:AT3G45960

ath:AT3G45970

ath:AT4G38400

dosa:Os03g0132200

dosa:Os10g0542400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.479

Rank 1 · LXL04_025298 · OH-1004

Cell membrane0.096

Rank 2 · LXL04_025298 · OH-1004

Plastid0.075

Rank 3 · LXL04_025298 · OH-1004

Lysosome / Vacuole0.071

Rank 4 · LXL04_025298 · OH-1004

Endoplasmic reticulum0.067

Rank 5 · LXL04_025298 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03330.25DPBB_170-145 aa

PF01357.28Expansin_C159-240 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025298	`PF03330.25`	DPBB_1	70	145	2.3e-09	38.1
LXL04_025298	`PF01357.28`	Expansin_C	159	240	1.4e-15	57.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LZT4`	Arabidopsis thaliana	Expansin-like A1	62.257%	Swiss-Prot	strong database homology
`Q9LZT5`	Arabidopsis thaliana	Expansin-like A3	60.078%	Swiss-Prot	strong database homology
`Q9SVE5`	Arabidopsis thaliana	Expansin-like A2	63.333%	Swiss-Prot	strong database homology
`Q7XCL0`	Oryza sativa subsp. japonica	Expansin-like A2	54.615%	Swiss-Prot	strong database homology
`Q10S70`	Oryza sativa subsp. japonica	Expansin-like A1	53.846%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card