LXL04_024878 | RubberDandelionOmics

Gene overview

LXL04_024878

Reference: OH-1004 Chr: Chr05 Coordinates: 101424927-101427685 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1293 bp · LXL04_024878|LXL04_024878|OH1004|cDNA

ATGGCTAAAGTTCATGGAATTATCTACTCTTCTGTTAAAACCCCTCATCATCCAACATCAAACAGCAATTCCCCACGATTGGTACCAAAGAAGTTCACCCATAGCCAAAGTTCAGTGTTAAAACTGAAGTTATCAGGCAAATCAAAACCGAATTCATGTGAAAAATCAAATAGTTCAGTCACCTCGCTGGCTTCTTCTTTCTTATGCCGGTCAAGAGAAACACAAACTGCAGAAACAGAAGAATGTGTAAACCACAATGA...

CDS

Download CDS FASTA

1293 bp · LXL04_024878|LXL04_024878|OH1004|CDS

ATGGCTAAAGTTCATGGAATTATCTACTCTTCTGTTAAAACCCCTCATCATCCAACATCAAACAGCAATTCCCCACGATTGGTACCAAAGAAGTTCACCCATAGCCAAAGTTCAGTGTTAAAACTGAAGTTATCAGGCAAATCAAAACCGAATTCATGTGAAAAATCAAATAGTTCAGTCACCTCGCTGGCTTCTTCTTTCTTATGCCGGTCAAGAGAAACACAAACTGCAGAAACAGAAGAATGTGTAAACCACAATGA...

Protein

Download Protein FASTA

430 aa · LXL04_024878|LXL04_024878|OH1004|PROTEIN

MAKVHGIIYSSVKTPHHPTSNSNSPRLVPKKFTHSQSSVLKLKLSGKSKPNSCEKSNSSVTSLASSFLCRSRETQTAETEECVNHNEEDSDHSRTQNTHEGRIGDTITNQALAEACRFAYNDARYVNERAKNDIFLLSRGIMRLDARARQDVAILGSGFLKLDARAREDTEKIDNNVKKRAERLHHIALILKKKAESKLKSVADQHWSDGALEADLRRADYIAKQRAMEDALMALEFIKDVQDMMMSKMYKLKNEALSSD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024878`
TK1151 ID	TkA06G098140
OH-1004 ID	LXL04_024878
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024878

Location Chr05:101424927-101427685 (+)

Description Similar to SPA15: Senescence-associated protein SPA15, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g66330`	Involved in modulation of redox homeostasis to regulate leaf senescence mediated by age and stress factors during plant development.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0148700`	May be involved in the regulation of leaf senescence.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024878 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010150 leaf senescence Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0072593 reactive oxygen species metabolic process Biological Process

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G66330

dosa:Os05g0148700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.939

Rank 1 · LXL04_024878 · OH-1004

Nucleus0.055

Rank 2 · LXL04_024878 · OH-1004

Mitochondrion0.044

Rank 3 · LXL04_024878 · OH-1004

Cytoplasm0.039

Rank 4 · LXL04_024878 · OH-1004

Cell membrane0.030

Rank 5 · LXL04_024878 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28580.1OSA15_N112-210 aa

PF30979.1OSA15_C313-413 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024878	`PF28580.1`	OSA15_N	112	210	3.9e-51	172.1
LXL04_024878	`PF30979.1`	OSA15_C	313	413	9.1e-53	178.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C8Y4`	Arabidopsis thaliana	Senescence-associated protein AAF, chloroplastic	68.044%	Swiss-Prot	strong database homology
`Q65XF2`	Oryza sativa subsp. japonica	Senescence-associated protein OSA15, chloroplastic	61.538%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card