LXL04_024853 | RubberDandelionOmics

Gene overview

LXL04_024853

Reference: OH-1004 Chr: Chr05 Coordinates: 100503085-100506561 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2472 bp · LXL04_024853|LXL04_024853|OH1004|cDNA

ATGGAAAGATCGAGCCGGAAACACAGGGATTCCGATCGCGATAGGGATAAGGATTCGTCCAAAGAGTACAAGCATCGAAGCAGCAAACACACCGATGACCACCATCGCTCCAAACACAGAGACACCGATGGAGATGATCGACGTCGAAGAGGGGAACGTGAGAGATCCGAAGACGTTGAAGATCGGGTGAAGCGTGAGAGGTCATACGATAGAGAAGGCAGCAAGGATAGGGAATTAAGAGAGAAATCGGTAGATAACAG...

CDS

Download CDS FASTA

2472 bp · LXL04_024853|LXL04_024853|OH1004|CDS

ATGGAAAGATCGAGCCGGAAACACAGGGATTCCGATCGCGATAGGGATAAGGATTCGTCCAAAGAGTACAAGCATCGAAGCAGCAAACACACCGATGACCACCATCGCTCCAAACACAGAGACACCGATGGAGATGATCGACGTCGAAGAGGGGAACGTGAGAGATCCGAAGACGTTGAAGATCGGGTGAAGCGTGAGAGGTCATACGATAGAGAAGGCAGCAAGGATAGGGAATTAAGAGAGAAATCGGTAGATAACAG...

Protein

Download Protein FASTA

823 aa · LXL04_024853|LXL04_024853|OH1004|PROTEIN

MERSSRKHRDSDRDRDKDSSKEYKHRSSKHTDDHHRSKHRDTDGDDRRRRGERERSEDVEDRVKRERSYDREGSKDRELREKSVDNRRHHNHKRKDRGGDSDEEDRYYEARDKRTRVADERKERRRFEDKVEDDRDREERKERRKFEDRVKKEDTDFIDNDGDKLQQEKLNGESMTTMKSEPNDEPYGGSNANGGALGSRSKAYGTPHETPLASSLPPPPPPKVSSISSKHENEGVNSNRSHEVPGKSSTDGTSTDAGKS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024853`
TK1151 ID	TkA06G101800
OH-1004 ID	LXL04_024853
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024853

Location Chr05:100503085-100506561 (-)

Description Similar to RDM16: Protein RDM16

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g28060`	Functions in the RNA-directed DNA methylation (RdDM) pathway.	A Pre-mRNA-splicing factor is required for RNA-directed DNA methylation in Arabidopsis.2013 · DOI: 10.1371/journal.pgen.1003779

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024853 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000244 spliceosomal tri-snRNP complex assembly Biological Process

GO:0000245 spliceosomal complex assembly Biological Process

GO:0000375 RNA splicing, via transesterification reactions Biological Process

GO:0000387 spliceosomal snRNP assembly Biological Process

GO:0000388 spliceosome conformational change to release U4 (or U4atac) and U1 (or U11) Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G28060

bta:510322

hsa:9129

mmu:70767

pon:100440626

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.972

Rank 1 · LXL04_024853 · OH-1004

Cytoplasm0.073

Rank 2 · LXL04_024853 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_024853 · OH-1004

Endoplasmic reticulum0.014

Rank 4 · LXL04_024853 · OH-1004

Mitochondrion0.006

Rank 5 · LXL04_024853 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08572.16PRP3437-666 aa

PF06544.19Prp3_C690-816 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024853	`PF08572.16`	PRP3	437	666	3.1e-62	210.8
LXL04_024853	`PF06544.19`	Prp3_C	690	816	8.1e-43	146.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C7E7`	Arabidopsis thaliana	Protein RDM16	55.146%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card