LXL04_024703 | RubberDandelionOmics

Gene overview

LXL04_024703

Reference: OH-1004 Chr: Chr05 Coordinates: 97065551-97067983 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1917 bp · LXL04_024703|LXL04_024703|OH1004|cDNA

ATGGCAACTAGTATAGCTTCTGGAAGCGCGAATTTACAATTCCGGGAGACATACTGCTGGCGACAAAGTTTTTTTTCTCCAATGGTGTCGCAGAGATGCTATAACAAATTCCCATGGTCAGATGGGGTGTCTACCAATATAAAAATCAAGAAATACCACTACCCAATTACTGAAACTCGAAGACCCTTCCAAAGAACTATAACATCATCAATAAAAAACGAATCCACAAAGTATTTCGATTTTGCCGTTATTGGCAGCGG...

CDS

Download CDS FASTA

1905 bp · LXL04_024703|LXL04_024703|OH1004|CDS

ATGGCAACTAGTATAGCTTCTGGAAGCGCGAATTTACAATTCCGGGAGACATACTGCTGGCGACAAAGTTTTTTTTCTCCAATGGTGTCGCAGAGATGCTATAACAAATTCCCATGGTCAGATGGGGTGTCTACCAATATAAAAATCAAGAAATACCACTACCCAATTACTGAAACTCGAAGACCCTTCCAAAGAACTATAACATCATCAATAAAAAACGAATCCACAAAGTATTTCGATTTTGCCGTTATTGGCAGCGG...

Protein

Download Protein FASTA

634 aa · LXL04_024703|LXL04_024703|OH1004|PROTEIN

MATSIASGSANLQFRETYCWRQSFFSPMVSQRCYNKFPWSDGVSTNIKIKKYHYPITETRRPFQRTITSSIKNESTKYFDFAVIGSGVAGLRYALEVAKHGTVAVITKAEPHESNTNYAQGGVSAVLCPSDSVESHMQDTIVAGAYLCDEETVRVVCTEGPERIRELIAMGASFDHGEDGNLHLAREGGHSHHRIVHAADMTGREIERALLKAIENDPSISVFKHHFAIDLLTSQNGSEMVCHGVDTIDTETRNVVRFIS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024703`
TK1151 ID	TkA06G116530
OH-1004 ID	LXL04_024703
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 99.373 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024703

Location Chr05:97065551-97067983 (+)

Description Similar to AO: L-aspartate oxidase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g14760`	Catalyzes the oxidation of L-aspartate to iminoaspartate.	Aspartate oxidase plays an important role in Arabidopsis stomatal immunity.2012 · DOI: 10.1104/pp.112.199810

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0134400`	Catalyzes the oxidation of L-aspartate to iminoaspartate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024703 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009435 NAD+ biosynthetic process Biological Process

GO:0009820 alkaloid metabolic process Biological Process

GO:0034628 'de novo' NAD+ biosynthetic process from L-aspartate Biological Process

GO:0042179 nicotine biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000166 nucleotide binding Molecular Function

GO:0008734 L-aspartate oxidase activity Molecular Function

KEGG gene cross-reference

ath:AT5G14760

dosa:Os02g0134400

nta:107775324

nta:107809102

rso:RSc2447

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.596

Rank 1 · LXL04_024703 · OH-1004

Mitochondrion0.439

Rank 2 · LXL04_024703 · OH-1004

Cytoplasm0.077

Rank 3 · LXL04_024703 · OH-1004

Nucleus0.038

Rank 4 · LXL04_024703 · OH-1004

Peroxisome0.022

Rank 5 · LXL04_024703 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00890.31FAD_binding_280-464 aa

PF01266.31DAO80-188 aa

PF02910.26Succ_DH_flav_C520-610 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024703	`PF00890.31`	FAD_binding_2	80	464	6.9e-89	299.6
LXL04_024703	`PF01266.31`	DAO	80	188	7.2e-08	33.1
LXL04_024703	`PF02910.26`	Succ_DH_flav_C	520	610	4.4e-16	59.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AY1`	Arabidopsis thaliana	L-aspartate oxidase, chloroplastic	72.601%	Swiss-Prot	strong database homology
`Q6Z836`	Oryza sativa subsp. japonica	L-aspartate oxidase, chloroplastic	75.747%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card