LXL04_024679 | RubberDandelionOmics

Gene overview

LXL04_024679

Reference: OH-1004 Chr: Chr05 Coordinates: 96569024-96573403 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2376 bp · LXL04_024679|LXL04_024679|OH1004|cDNA

ATGATGTCTGACGGCGTTGAAGACGAAGAGAAATGGCTGACAGCTGGCATCGCCGGCCTCCAACAGAACGCCTTTTACATGCATCGCGCTTTGGATTCGAACAATATAAAGGACGCGTTGAAATACTCTGCTCAGATGCTGTCGGAGTTGCGTACTTCGAGGCTTTCCCCTCACAAATACTATGAGCTCTATATGAGGGCATTCGATGAGTTGAGGAAGCTGGAGATATTTTTTAAGGAGGAGAGCAAGCGTAGTTGCTC...

CDS

Download CDS FASTA

2376 bp · LXL04_024679|LXL04_024679|OH1004|CDS

ATGATGTCTGACGGCGTTGAAGACGAAGAGAAATGGCTGACAGCTGGCATCGCCGGCCTCCAACAGAACGCCTTTTACATGCATCGCGCTTTGGATTCGAACAATATAAAGGACGCGTTGAAATACTCTGCTCAGATGCTGTCGGAGTTGCGTACTTCGAGGCTTTCCCCTCACAAATACTATGAGCTCTATATGAGGGCATTCGATGAGTTGAGGAAGCTGGAGATATTTTTTAAGGAGGAGAGCAAGCGTAGTTGCTC...

Protein

Download Protein FASTA

791 aa · LXL04_024679|LXL04_024679|OH1004|PROTEIN

MMSDGVEDEEKWLTAGIAGLQQNAFYMHRALDSNNIKDALKYSAQMLSELRTSRLSPHKYYELYMRAFDELRKLEIFFKEESKRSCSIIELYELVQHAGNILPRLYLLCTVGSVYIRSKEAPAKDILKDLVEMCRGIQHPLRGLFLRSYLSQVSRDKLPDIGSEYEGDENTVMDAVEFVLQNFTEMNKLWVRMQHQGPAREKEKREKERNELRDLVGKNLHVLGQIEGIDLELYRDTVLPRILEQVVNCKDDLAQYYLMD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024679`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024679

Location Chr05:96569024-96573403 (-)

Description Similar to VPS35B: Vacuolar protein sorting-associated protein 35B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g75850`	Plays a role in vesicular protein sorting.	Arabidopsis VPS35, a retromer component, is required for vacuolar protein sorting and involved in plant growth and leaf senescence.2008 · DOI: 10.1093/pcp/pcn006
`At2g17790`	Plays a role in vesicular protein sorting.	Loss-of-function mutations of retromer large subunit genes suppress the phenotype of an Arabidopsis zig mutant that lacks Qb-SNARE VTI11.2010 · DOI: 10.1105/tpc.109.069294
`At3g51310`	Plays a role in vesicular protein sorting.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024679 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006624 vacuolar protein processing Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0007040 lysosome organization Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0010821 regulation of mitochondrion organization Biological Process

GO:0031647 regulation of protein stability Biological Process

GO:0031648 protein destabilization Biological Process

GO:0032456 endocytic recycling Biological Process

GO:0032463 negative regulation of protein homooligomerization Biological Process

GO:0036010 protein localization to endosome Biological Process

GO:0042147 retrograde transport, endosome to Golgi Biological Process

KEGG gene cross-reference

ath:AT1G75850

ath:AT2G17790

ath:AT3G51310

bta:521864

mmu:65114

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.584

Rank 1 · LXL04_024679 · OH-1004

Nucleus0.334

Rank 2 · LXL04_024679 · OH-1004

Golgi apparatus0.171

Rank 3 · LXL04_024679 · OH-1004

Lysosome / Vacuole0.133

Rank 4 · LXL04_024679 · OH-1004

Cell membrane0.096

Rank 5 · LXL04_024679 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03635.24Vps3512-747 aa

PF27614.1VPS35L_N100-157 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024679	`PF03635.24`	Vps35	12	747	1.6e-287	956.7
LXL04_024679	`PF27614.1`	VPS35L_N	100	157	6.3e-07	29.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I0P8`	Arabidopsis thaliana	Vacuolar protein sorting-associated protein 35B	74.619%	Swiss-Prot	strong database homology
`Q7X659`	Arabidopsis thaliana	Vacuolar protein sorting-associated protein 35A	75.253%	Swiss-Prot	strong database homology
`A8R7K9`	Arabidopsis thaliana	Vacuolar protein sorting-associated protein 35C	71.863%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card