LXL04_024677 | RubberDandelionOmics

Gene overview

LXL04_024677

Reference: OH-1004 Chr: Chr05 Coordinates: 96561861-96564346 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1701 bp · LXL04_024677|LXL04_024677|OH1004|cDNA

ATGGGAAAAAGGGCAACCATTGTTTTATCATCATCGGACGATGATGACAAGGACTTTGCAGCGGAGTCGATTTTGAAGTATTTCAAGAAGCCGAAAGCGGGAGCGGCATCTGTTCCTCGAACTAGCAGTAAGGGATCGAAGAAAGCTCGGATTTCGAGCTCTCGTTCTCATCCTGGCAAAACTGGCAATCCGTTTGACGAGATGAAAATGTTCTGTGAGGATTTCGGTGAAGGTTTTACTGGGTTCAAGGTACCTCCTGG...

CDS

Download CDS FASTA

1701 bp · LXL04_024677|LXL04_024677|OH1004|CDS

ATGGGAAAAAGGGCAACCATTGTTTTATCATCATCGGACGATGATGACAAGGACTTTGCAGCGGAGTCGATTTTGAAGTATTTCAAGAAGCCGAAAGCGGGAGCGGCATCTGTTCCTCGAACTAGCAGTAAGGGATCGAAGAAAGCTCGGATTTCGAGCTCTCGTTCTCATCCTGGCAAAACTGGCAATCCGTTTGACGAGATGAAAATGTTCTGTGAGGATTTCGGTGAAGGTTTTACTGGGTTCAAGGTACCTCCTGG...

Protein

Download Protein FASTA

566 aa · LXL04_024677|LXL04_024677|OH1004|PROTEIN

MGKRATIVLSSSDDDDKDFAAESILKYFKKPKAGAASVPRTSSKGSKKARISSSRSHPGKTGNPFDEMKMFCEDFGEGFTGFKVPPGHKRDDKELWVDKYKPRSLLDLSVHKKKVEEVKLWLEERIITKNNNHYNHVLVISGQPGVGKSATVHTIASHLGATVYEWNTPTPTIWQEHLHTTNAGLRYMSKLDEFEIFVDKIRKYGLISSQKKPFIILIDDLPVTNGKISLARLQRCLNLLVQSVCIPTVILITDYGKTET...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024677`
TK1151 ID	TkA06G117770
OH-1004 ID	LXL04_024677
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024677

Location Chr05:96561861-96564346 (-)

Description Similar to RAD17: Cell cycle checkpoint protein RAD17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g66130`	Seems to be involved in regulation of DNA repair correlated to non-homologous double strand breaks (DSBs) repair.	The Rad17 homologue of Arabidopsis is involved in the regulation of DNA damage repair and homologous recombination.2004 · DOI: 10.1111/j.1365-313x.2004.02097.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024677 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000076 DNA replication checkpoint signaling Biological Process

GO:0000077 DNA damage checkpoint signaling Biological Process

GO:0006281 DNA repair Biological Process

GO:0006282 regulation of DNA repair Biological Process

GO:0006952 defense response Biological Process

GO:0006974 DNA damage response Biological Process

GO:0008156 negative regulation of DNA replication Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0031573 mitotic intra-S DNA damage checkpoint signaling Biological Process

GO:0033314 mitotic DNA replication checkpoint signaling Biological Process

GO:0042325 regulation of phosphorylation Biological Process

GO:1990166 protein localization to site of double-strand break Biological Process

KEGG gene cross-reference

ath:AT5G66130

hsa:5884

mmu:19356

pon:100190842

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.930

Rank 1 · LXL04_024677 · OH-1004

Cytoplasm0.114

Rank 2 · LXL04_024677 · OH-1004

Mitochondrion0.023

Rank 3 · LXL04_024677 · OH-1004

Cell membrane0.022

Rank 4 · LXL04_024677 · OH-1004

Endoplasmic reticulum0.011

Rank 5 · LXL04_024677 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03215.22Rad1789-257 aa

PF25361.2AAA_lid_RFC1290-337 aa

PF21960.3RCF1-5-like_lid296-332 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024677	`PF03215.22`	Rad17	89	257	9.3e-26	91.6
LXL04_024677	`PF25361.2`	AAA_lid_RFC1	290	337	2.4e-09	37.2
LXL04_024677	`PF21960.3`	RCF1-5-like_lid	296	332	8.5e-08	32.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9MBA3`	Arabidopsis thaliana	Cell cycle checkpoint protein RAD17	50.764%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card