LXL04_024632 | RubberDandelionOmics

Gene overview

LXL04_024632

Reference: OH-1004 Chr: Chr05 Coordinates: 95536539-95539257 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2040 bp · LXL04_024632|LXL04_024632|OH1004|cDNA

ATGTCGGATGAAATGGGTTTCTTCAAACCACTAAACAacaatgaagaagaagaatctTCACCGATTAATAAAAACTTTATAGAATCGATGTTGTTCAAGGAAGAAGAGATCAATGTTGTTCAAGGAGGAAAGAAAGGAACCATATTTGTGTGTGCTGAAGGTGGAATTGGAGGTTGGGTGTGGCTGGGATCGGCGACTGGCAATGACAGAGGAGGAGATCAGTGCTGTTGTGTGTGCGATGTGCTCAGTGTGTGCGACGA...

CDS

Download CDS FASTA

2040 bp · LXL04_024632|LXL04_024632|OH1004|CDS

ATGTCGGATGAAATGGGTTTCTTCAAACCACTAAACAACAATGAAGAAGAAGAATCTTCACCGATTAATAAAAACTTTATAGAATCGATGTTGTTCAAGGAAGAAGAGATCAATGTTGTTCAAGGAGGAAAGAAAGGAACCATATTTGTGTGTGCTGAAGGTGGAATTGGAGGTTGGGTGTGGCTGGGATCGGCGACTGGCAATGACAGAGGAGGAGATCAGTGCTGTTGTGTGTGCGATGTGCTCAGTGTGTGCGACGA...

Protein

Download Protein FASTA

679 aa · LXL04_024632|LXL04_024632|OH1004|PROTEIN

MSDEMGFFKPLNNNEEEESSPINKNFIESMLFKEEEINVVQGGKKGTIFVCAEGGIGGWVWLGSATGNDRGGDQCCCVCDVLSVCDENSSATSMEIQTRMNTFHLIFFSLLFYLLTSQACHPIDHHALLDFKHKITSDPSNLLESWKPQTDCCRSWDGIACDSAGRVINVSRSGLISGKDSMVDTSMSGTLSPSLSNLTFLQLLELSQLKDLTGRIPPEFGKLSRLTHLYLHSNKLSGSVPDTFRLLFRLEELYLSNNHF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024632`
TK1151 ID	TkA06G122880
OH-1004 ID	LXL04_024632
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	70.800
Protein coverage (%)	TK1151 57.770 / OH-1004 34.757 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024632

Location Chr05:95536539-95539257 (+)

Description Similar to FLS2: LRR receptor-like serine/threonine-protein kinase FLS2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g46330`	Constitutes the pattern-recognition receptor (PPR) that determines the specific perception of flagellin (flg22), a potent elicitor of the defense response to pathogen-associated molecular patterns (PAMPs).	No verified direct reference in this release
`At5g44700`	Together with GSO1, receptor-like serine/threonine-kinase required during the development of the epidermal surface in embryos and cotyledons.	GASSHO1 and GASSHO2 encoding a putative leucine-rich repeat transmembrane-type receptor kinase are essential for the normal development of the epidermal surface in Arabidopsis embryos.2008 · DOI: 10.1111/j.1365-313x.2007.03395.x The receptor-like kinases GSO1 and GSO2 together regulate root growth in Arabidopsis through control of cell division and cell fate specification.2014 · DOI: 10.1002/dvdy.24066 A peptide hormone required for Casparian strip diffusion barrier formation in Arabidopsis roots.2017 · DOI: 10.1126/science.aai9057
`At4g20140`	Together with GSO2, receptor-like serine/threonine-kinase required during the development of the epidermal surface in embryos and cotyledons.	GASSHO1 and GASSHO2 encoding a putative leucine-rich repeat transmembrane-type receptor kinase are essential for the normal development of the epidermal surface in Arabidopsis embryos.2008 · DOI: 10.1111/j.1365-313x.2007.03395.x The receptor-like kinases GSO1 and GSO2 together regulate root growth in Arabidopsis through control of cell division and cell fate specification.2014 · DOI: 10.1002/dvdy.24066 A peptide hormone required for Casparian strip diffusion barrier formation in Arabidopsis roots.2017 · DOI: 10.1126/science.aai9057
`At1g35710`	Probable leucine-rich repeat receptor-like protein kinase At1g35710.	No verified direct reference in this release
`At1g08590`	Involved in the regulation of procambium maintenance and polarity during vascular-tissue development.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024632 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006898 receptor-mediated endocytosis Biological Process

GO:0009553 embryo sac development Biological Process

GO:0016045 detection of bacterium Biological Process

GO:0042659 regulation of cell fate specification Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0051302 regulation of cell division Biological Process

GO:0052544 defense response by callose deposition in cell wall Biological Process

GO:0090708 specification of plant organ axis polarity Biological Process

GO:0140426 pathogen-associated molecular pattern receptor signaling pathway Biological Process

GO:0160073 Casparian strip assembly Biological Process

GO:2000067 regulation of root morphogenesis Biological Process

GO:2000280 regulation of root development Biological Process

KEGG gene cross-reference

ath:AT5G44700

ath:AT5G46330

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.679

Rank 1 · LXL04_024632 · OH-1004

Endoplasmic reticulum0.116

Rank 2 · LXL04_024632 · OH-1004

Extracellular0.113

Rank 3 · LXL04_024632 · OH-1004

Cytoplasm0.088

Rank 4 · LXL04_024632 · OH-1004

Nucleus0.065

Rank 5 · LXL04_024632 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_2124-162 aa

PF23598.2LRR_14189-257 aa

PF13855.13LRR_8220-260 aa

PF13855.13LRR_8224-285 aa

PF12799.14LRR_4249-287 aa

PF13855.13LRR_8273-333 aa

PF23598.2LRR_14288-352 aa

PF13855.13LRR_8299-357 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024632	`PF08263.18`	LRRNT_2	124	162	1.1e-10	42.3
LXL04_024632	`PF23598.2`	LRR_14	189	257	4.5e-25	88.9
LXL04_024632	`PF13855.13`	LRR_8	220	260	4.6e-46	155.1
LXL04_024632	`PF13855.13`	LRR_8	224	285	4.6e-46	155.1
LXL04_024632	`PF12799.14`	LRR_4	249	287	5.7e-28	97.0
LXL04_024632	`PF13855.13`	LRR_8	273	333	4.6e-46	155.1
LXL04_024632	`PF23598.2`	LRR_14	288	352	4.5e-25	88.9
LXL04_024632	`PF13855.13`	LRR_8	299	357	4.6e-46	155.1
LXL04_024632	`PF13855.13`	LRR_8	322	381	4.6e-46	155.1
LXL04_024632	`PF12799.14`	LRR_4	322	357	5.7e-28	97.0
LXL04_024632	`PF23598.2`	LRR_14	358	444	4.5e-25	88.9
LXL04_024632	`PF13855.13`	LRR_8	403	446	4.6e-46	155.1
LXL04_024632	`PF13855.13`	LRR_8	486	542	4.6e-46	155.1
LXL04_024632	`PF13855.13`	LRR_8	587	644	4.6e-46	155.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FL28`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase FLS2	34.872%	Swiss-Prot	moderate database homology
`Q9FIZ3`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase GSO2	34.411%	Swiss-Prot	moderate database homology
`C0LGQ5`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase GSO1	35.551%	Swiss-Prot	moderate database homology
`Q9LP24`	Arabidopsis thaliana	Probable leucine-rich repeat receptor-like protein kinase At1g35710	33.005%	Swiss-Prot	moderate database homology
`Q9FRS6`	Arabidopsis thaliana	Leucine-rich repeat receptor-like protein kinase PXL1	32.188%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card