LXL04_024493 | RubberDandelionOmics

Gene overview

LXL04_024493

Reference: OH-1004 Chr: Chr05 Coordinates: 91968960-91970551 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

507 bp · LXL04_024493|LXL04_024493|OH1004|cDNA

atgtctgcgccgcgcagacTGCGCGCAGACATTGGTGTTTGCAgcGCTGCACTCCAtcgttcatcttcttcttcggcTCTTCTTCGTTCAACTGCACCCCACACAGCTTCTCCACCTATATCATTCTCATCATCTCGCGCCGGCAGAATGCCCTTTTCCGACGCCGTCAATGGCGGCTGCTTGCCCTATTCGGACGCCGACGTCGCCTGCTCGCCGCCGCTCTCTTCCTGCTTCCTTCGTCCTTCCGAAAACCTCCCCCA...

CDS

Download CDS FASTA

507 bp · LXL04_024493|LXL04_024493|OH1004|CDS

ATGTCTGCGCCGCGCAGACTGCGCGCAGACATTGGTGTTTGCAGCGCTGCACTCCATCGTTCATCTTCTTCTTCGGCTCTTCTTCGTTCAACTGCACCCCACACAGCTTCTCCACCTATATCATTCTCATCATCTCGCGCCGGCAGAATGCCCTTTTCCGACGCCGTCAATGGCGGCTGCTTGCCCTATTCGGACGCCGACGTCGCCTGCTCGCCGCCGCTCTCTTCCTGCTTCCTTCGTCCTTCCGAAAACCTCCCCCA...

Protein

Download Protein FASTA

168 aa · LXL04_024493|LXL04_024493|OH1004|PROTEIN

MSAPRRLRADIGVCSAALHRSSSSSALLRSTAPHTASPPISFSSSRAGRMPFSDAVNGGCLPYSDADVACSPPLSSCFLRPSENLPHRFDNQNKLATKSITVAGKWQQQQLRRLNIHEYQGAELMGKFGINVPKGVAVSSVEEVRKAIQTTFPNEKEVPIDVFKKNYI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024493`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024493

Location Chr05:91968960-91970551 (-)

Description Similar to Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20420`	Succinyl-CoA synthetase functions in the citric acid cycle (TCA), coupling the hydrolysis of succinyl-CoA to the synthesis of ATP and thus represents the only step of substrate-level phosphorylation in the TCA.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0621700`	Succinyl-CoA synthetase functions in the citric acid cycle (TCA), coupling the hydrolysis of succinyl-CoA to the synthesis of ATP and thus represents the only step of substrate-level phosphorylation in the TCA.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024493 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006104 succinyl-CoA metabolic process Biological Process

GO:0006105 succinate metabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0042709 succinate-CoA ligase complex Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0004775 succinate-CoA ligase (ADP-forming) activity Molecular Function

GO:0004776 succinate-CoA ligase (GDP-forming) activity Molecular Function

GO:0005507 copper ion binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT2G20420

dosa:Os02g0621700

paa:Paes_0607

plt:Plut_0497

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.475

Rank 1 · LXL04_024493 · OH-1004

Mitochondrion0.384

Rank 2 · LXL04_024493 · OH-1004

Nucleus0.078

Rank 3 · LXL04_024493 · OH-1004

Cytoplasm0.029

Rank 4 · LXL04_024493 · OH-1004

Cell membrane0.008

Rank 5 · LXL04_024493 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82662`	Arabidopsis thaliana	Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrial	72.059%	Swiss-Prot	weak database homology
`Q6K9N6`	Oryza sativa subsp. japonica	Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrial	66.176%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card