LXL04_024407 | RubberDandelionOmics

Gene overview

LXL04_024407

Reference: OH-1004 Chr: Chr05 Coordinates: 89837479-89839987 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1264 bp · LXL04_024407|LXL04_024407|OH1004|cDNA

AAGATTCCGCCATCTGGGTTTTTTCTAATTGCAGAAAATGGGCAGAAAGGGTGGTGTTGAATCGAGTGATAACAATCAAAGAATTGATGGACCAATAACCAAAGAACAAGGAAAGGGGAAGAAATTATGGAACAAGATGAAGTATCAGCTGGTTGAATACCATTCGTTGCCTGCGTATATGAAAGATAACGAATTCATATTAGGCCATTATCGTGCTGAATGGCCTCTCAAGCAGATTTTTTTGAGCATGTTCTCCCTTC...

CDS

Download CDS FASTA

1236 bp · LXL04_024407|LXL04_024407|OH1004|CDS

TTGCAGAAAATGGGCAGAAAGGGTGGTGTTGAATCGAGTGATAACAATCAAAGAATTGATGGACCAATAACCAAAGAACAAGGAAAGGGGAAGAAATTATGGAACAAGATGAAGTATCAGCTGGTTGAATACCATTCGTTGCCTGCGTATATGAAAGATAACGAATTCATATTAGGCCATTATCGTGCTGAATGGCCTCTCAAGCAGATTTTTTTGAGCATGTTCTCCCTTCACAACGAAACCCTTAACGTTTGGACACA...

Protein

Download Protein FASTA

411 aa · LXL04_024407|LXL04_024407|OH1004|PROTEIN

MQKMGRKGGVESSDNNQRIDGPITKEQGKGKKLWNKMKYQLVEYHSLPAYMKDNEFILGHYRAEWPLKQIFLSMFSLHNETLNVWTHLIGFFLFLTLTIYSAKMINVVDIPTLKHFPDVLRRADVYKLREDLLTCIPSLPNMPDLQKLRHEIKTSFHASSDLLPLMSNWHIVELLTNCLPERFSHSNHTDVCVLQSMKEDVANIIAPLMTHPTTKWPFFAFLGGAMFCLLASSLCHLLCCHSKRLSYIMLRVDYAGIAAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024407`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024407

Location Chr05:89837479-89839987 (+)

Description Similar to ADIPOR3: Heptahelical transmembrane protein ADIPOR3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g37680`	May play a role in abiotic stress response.	No verified direct reference in this release
`At4g38320`	May play a role in abiotic stress response.	No verified direct reference in this release
`At2g24150`	May play a role in abiotic stress response.	No verified direct reference in this release
`At4g30850`	May play a role in abiotic stress response.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0232900`	May play a role in abiotic stress response.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024407 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006979 response to oxidative stress Biological Process

GO:0009725 response to hormone Biological Process

GO:0009744 response to sucrose Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0016020 membrane Cellular Component

GO:0038023 signaling receptor activity Molecular Function

KEGG gene cross-reference

ath:AT2G24150

ath:AT4G30850

ath:AT4G37680

ath:AT4G38320

dosa:Os03g0232900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.445

Rank 1 · LXL04_024407 · OH-1004

Cytoplasm0.186

Rank 2 · LXL04_024407 · OH-1004

Endoplasmic reticulum0.180

Rank 3 · LXL04_024407 · OH-1004

Golgi apparatus0.131

Rank 4 · LXL04_024407 · OH-1004

Lysosome / Vacuole0.126

Rank 5 · LXL04_024407 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03006.27HlyIII75-396 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024407	`PF03006.27`	HlyIII	75	396	1e-61	209.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SZG0`	Arabidopsis thaliana	Heptahelical transmembrane protein 4	65.207%	Swiss-Prot	strong database homology
`Q9SVF3`	Arabidopsis thaliana	Heptahelical transmembrane protein 5	63.750%	Swiss-Prot	strong database homology
`Q9ZUH8`	Arabidopsis thaliana	Heptahelical transmembrane protein 3	37.802%	Swiss-Prot	moderate database homology
`Q84N34`	Arabidopsis thaliana	Heptahelical transmembrane protein 2	35.351%	Swiss-Prot	moderate database homology
`Q10PI5`	Oryza sativa subsp. japonica	Heptahelical transmembrane protein ADIPOR3	67.700%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card