LXL04_024401 | RubberDandelionOmics

Gene overview

LXL04_024401

Reference: OH-1004 Chr: Chr05 Coordinates: 89665097-89668180 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1779 bp · LXL04_024401|LXL04_024401|OH1004|cDNA

ATGGGGAAGAAACAACACAGCAAAGACCGGATGTACCTTACGAAGACAGAGTGGGCCACCGAGTGGGGCGGTGCCAAGTCCAAAGAACTCCGCACACCTTTCAAACGTCTCCCCTTCTATTGCTGCGCGCTTACATTTACTCCATTCGAGGACGCGGTGTGCACTGAGGATGGCAGCGTTTTCGATATCATGCACATAGTCCCCTACATAAGGAAATATGGAAAGCATCCTGTTTCTGGAACTCCTCTCAAACAAGAGGA...

CDS

Download CDS FASTA

1779 bp · LXL04_024401|LXL04_024401|OH1004|CDS

ATGGGGAAGAAACAACACAGCAAAGACCGGATGTACCTTACGAAGACAGAGTGGGCCACCGAGTGGGGCGGTGCCAAGTCCAAAGAACTCCGCACACCTTTCAAACGTCTCCCCTTCTATTGCTGCGCGCTTACATTTACTCCATTCGAGGACGCGGTGTGCACTGAGGATGGCAGCGTTTTCGATATCATGCACATAGTCCCCTACATAAGGAAATATGGAAAGCATCCTGTTTCTGGAACTCCTCTCAAACAAGAGGA...

Protein

Download Protein FASTA

592 aa · LXL04_024401|LXL04_024401|OH1004|PROTEIN

MGKKQHSKDRMYLTKTEWATEWGGAKSKELRTPFKRLPFYCCALTFTPFEDAVCTEDGSVFDIMHIVPYIRKYGKHPVSGTPLKQEDLIPLTFHKNSEGEYHCPVLNKVFTEFTHIVAIKTTGNVFSYEAVKELNLKTKNWKELLTDEPFKRQDIITIQNPNSLDSKALVDFDHVKKSLKVDDEEMQKMESDPSYNINTTGDIKQMLKDLKTEKGREIALHGGGGDKAQSERAAALTAILAARDRIKKDDEKLKVKQSQP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024401`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024401

Location Chr05:89665097-89668180 (+)

Description Similar to CYP65: Peptidyl-prolyl cis-trans isomerase CYP65

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g67530`	May catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides thereby assisting the folding of proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024401 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000209 protein polyubiquitination Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006457 protein folding Biological Process

GO:0008380 RNA splicing Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0072659 protein localization to plasma membrane Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005796 Golgi lumen Cellular Component

KEGG gene cross-reference

ani:ANIA_06894

ath:AT5G67530

hsa:23759

mmu:66053

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.905

Rank 1 · LXL04_024401 · OH-1004

Cytoplasm0.154

Rank 2 · LXL04_024401 · OH-1004

Mitochondrion0.022

Rank 3 · LXL04_024401 · OH-1004

Cell membrane0.021

Rank 4 · LXL04_024401 · OH-1004

Endoplasmic reticulum0.011

Rank 5 · LXL04_024401 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00160.27Pro_isomerase348-499 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024401	`PF00160.27`	Pro_isomerase	348	499	5.3e-51	173.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJX0`	Arabidopsis thaliana	Peptidyl-prolyl cis-trans isomerase CYP65	74.833%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card