Gene Card
Gene overview
cDNA / CDS / Protein Sequences
8892 bp · LXL04_024272|LXL04_024272|OH1004|cDNA
ATGTTTATAACCAACTTTATTAAGCGCAAGTTAGAATCAGTGTTGCAACCATGGCTGCTACAAGAACCGGAGTTGGAACTCAAGTTAGGGTTTCTTCGTTCTCATGGAATCGCCAAAAACCTCCGCTTCAATACTTCAGCACTCAACGAGCTTCTCGACGATTCTAGTGGCTTTTACTTTACCAATTTCAGAATTGATCAATTGACCATCCGAATAACCAACTGGTCTGCTCCAGCATTCAATTGGGAAGTTCAAGGTTT...
8892 bp · LXL04_024272|LXL04_024272|OH1004|CDS
ATGTTTATAACCAACTTTATTAAGCGCAAGTTAGAATCAGTGTTGCAACCATGGCTGCTACAAGAACCGGAGTTGGAACTCAAGTTAGGGTTTCTTCGTTCTCATGGAATCGCCAAAAACCTCCGCTTCAATACTTCAGCACTCAACGAGCTTCTCGACGATTCTAGTGGCTTTTACTTTACCAATTTCAGAATTGATCAATTGACCATCCGAATAACCAACTGGTCTGCTCCAGCATTCAATTGGGAAGTTCAAGGTTT...
Protein
Download Protein FASTA2963 aa · LXL04_024272|LXL04_024272|OH1004|PROTEIN
MFITNFIKRKLESVLQPWLLQEPELELKLGFLRSHGIAKNLRFNTSALNELLDDSSGFYFTNFRIDQLTIRITNWSAPAFNWEVQGFHVTISPRIVEGRGRSREPSEVLLEDKKKVLREIDPEGSELHDIMEKLANITPSRSQKTSLPNLILNYCSLQISDINLQLQTAISVDSYACLLEIEELNAGSRLVKPQSILRGYINSLIVNPKESCFDLEIRGLEIRLKSHDHITPLCSATDITCSSKLNDLQLIELHCSIEEL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_024272 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_024272 |
|---|---|
| Location | Chr05:86280416-86293044 (+) |
| Description | Similar to tipC: Putative vacuolar protein sorting-associated protein 13C |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000045 autophagosome assembly Biological Process GO:0006623 protein targeting to vacuole Biological Process GO:0006869 lipid transport Biological Process GO:0007005 mitochondrion organization Biological Process GO:0016236 macroautophagy Biological Process GO:0045053 protein retention in Golgi apparatus Biological Process GO:0045324 late endosome to vacuole transport Biological Process GO:0120009 intermembrane lipid transfer Biological Process GO:0120010 intermembrane phospholipid transfer Biological Process GO:0005768 endosome Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0005829 cytosol Cellular Component |
| KEGG gene cross-reference | cthr:CTHT_0020450 ddi:DDB_G0267422 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF25036.3VPS13_VAB1885-2307 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_024272 | PF25036.3 | VPS13_VAB | 1885 | 2307 | 3.8e-26 | 92.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.