LXL04_024168 | RubberDandelionOmics

Gene overview

LXL04_024168

Reference: OH-1004 Chr: Chr05 Coordinates: 83060066-83062007 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

879 bp · LXL04_024168|LXL04_024168|OH1004|cDNA

ATGTGCATTTCACGTGCAAACACCCCTCCCGGTATATTTACCAGCGGTGAAACCACGAAAAGGGCAAACAGAGCCACCGGCAGTAAGGTCCTTCTCAAAATGGCTTTTCTTAGTAGATTCGGCAATCTGCTCAAACAATCAGGAAGCAAGCATGTCAGTATGGGATTATCTTCCTCAAACTCACCACTTTTCCAGTCAATCAGAAGCATGTCATCTGCTAAACTCTTCATTGGAGGTCTTTCTTACGGAACTGATGAAAT...

CDS

Download CDS FASTA

879 bp · LXL04_024168|LXL04_024168|OH1004|CDS

ATGTGCATTTCACGTGCAAACACCCCTCCCGGTATATTTACCAGCGGTGAAACCACGAAAAGGGCAAACAGAGCCACCGGCAGTAAGGTCCTTCTCAAAATGGCTTTTCTTAGTAGATTCGGCAATCTGCTCAAACAATCAGGAAGCAAGCATGTCAGTATGGGATTATCTTCCTCAAACTCACCACTTTTCCAGTCAATCAGAAGCATGTCATCTGCTAAACTCTTCATTGGAGGTCTTTCTTACGGAACTGATGAAAT...

Protein

Download Protein FASTA

292 aa · LXL04_024168|LXL04_024168|OH1004|PROTEIN

MCISRANTPPGIFTSGETTKRANRATGSKVLLKMAFLSRFGNLLKQSGSKHVSMGLSSSNSPLFQSIRSMSSAKLFIGGLSYGTDEMGLKEAFQQYGEVIDGTYLSASIGVKLTDIIGCGFTKSVVIFAVRVITDRESGRSRGFGFVSYTSADAANSALHDMDGKELHGRRIRVSVAQEKPRPSFGGGGYGGAGGGGYGAGGAGGYGGTGGYGGGGGGGGYGGGSHNVGGYGGGNQNAGGGHDLFSGVLGGGGGGGGGAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024168`
TK1151 ID	TkA06G170660
OH-1004 ID	LXL04_024168
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	79.700
Protein coverage (%)	TK1151 82.192 / OH-1004 50.685 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024168

Location Chr05:83060066-83062007 (-)

Description Similar to RBG3: Glycine-rich RNA-binding protein 3, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61030`	Possibly has a role in RNA transcription or processing during stress (By similarity).	Two RNA recognition motif-containing proteins are plant mitochondrial editing factors.2015 · DOI: 10.1093/nar/gkv245
`At3g23830`	Possibly has a role in RNA transcription or processing during stress.	Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress.2005 · DOI: 10.1093/jxb/eri298
`At4g13850`	Promotes the cis-splicing and editing of several mitochondrial RNAs (including NAD5 transcripts).	No verified direct reference in this release
`At1g74230`	Possibly has a role in RNA transcription or processing during stress (By similarity).	RNA Recognition Motif-Containing Protein ORRM4 Broadly Affects Mitochondrial RNA Editing and Impacts Plant Development and Flowering.2016 · DOI: 10.1104/pp.15.01280

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024168 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0006858 extracellular transport Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009631 cold acclimation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009845 seed germination Biological Process

GO:0016554 cytidine to uridine editing Biological Process

GO:0050658 RNA transport Biological Process

GO:0050688 regulation of defense response to virus Biological Process

GO:0060567 negative regulation of termination of DNA-templated transcription Biological Process

KEGG gene cross-reference

ath:AT1G74230

ath:AT3G23830

ath:AT4G13850

ath:AT5G61030

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.845

Rank 1 · LXL04_024168 · OH-1004

Plastid0.110

Rank 2 · LXL04_024168 · OH-1004

Cytoplasm0.099

Rank 3 · LXL04_024168 · OH-1004

Nucleus0.068

Rank 4 · LXL04_024168 · OH-1004

Extracellular0.023

Rank 5 · LXL04_024168 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_1129-173 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024168	`PF00076.29`	RRM_1	129	173	5.9e-17	62.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FNR1`	Arabidopsis thaliana	Glycine-rich RNA-binding protein 3, mitochondrial	46.939%	Swiss-Prot	moderate database homology
`Q9LIS2`	Arabidopsis thaliana	Glycine-rich RNA-binding protein 4, mitochondrial	43.671%	Swiss-Prot	moderate database homology
`Q9SVM8`	Arabidopsis thaliana	Glycine-rich RNA-binding protein 2, mitochondrial	40.541%	Swiss-Prot	moderate database homology
`Q9C909`	Arabidopsis thaliana	Glycine-rich RNA-binding protein 5, mitochondrial	39.409%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card